Ametastegia pallipes

(Spinola, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Ametastegia

At a glance

Occurrence records893

Data sources9

Biological traits0

DNA specimens127

eDNA detections303

Sources9 archives

Databases and archives Ametastegia pallipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility893 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI303 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics127 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF893 records

Environmental DNA4 datasets · 13 countries303 detections

DNA & barcodingBOLD127 specimens

Genome at a glanceGoaT · TreeOfSex2n = 12

01Narrative

Ametastegia pallipes, the violet sawfly, is a species of common sawfly in the family Tenthredinidae. It is found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding127 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ametastegia pallipes has left across the world's sequence archives.

At a glance

DNA specimens127

BINs1

Marker genes1

eDNA detections303

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus105 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

82Amostly conserved

409Amostly conserved

493Gmostly conserved

TCTTTATTTTATTTTTGGATTCTGATCAGGAATAATTGGTCTTTCTTTTAGAATATTAATTCGAACAGAATTAGGAATACCAGGATCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes8

BIN1

Most divergent pair10.1%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia persicasame genus3.4%Ametastegia perlasame genus8.1%Ametastegia albipessame genus8.1%Ametastegia apertasame genus8.6%Ametastegia tibialissame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Ametastegia pallipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records6–202n range12median12mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 123×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 61×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

2n 201×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type893 records

Wild obs. + sensor310

Museum / vouchered583

Range

Area of Occupancy AOO1 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 102≤1 km 38≤10 km 95>10 km 2

237 georeferenced · 73 without coordinates

Open the mapobservation + sensor310

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 130≤1 km 43≤10 km 97>10 km 2

272 georeferenced · 311 without coordinates

Open the institutions mapphysical evidence583

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	105
BioFokuslocation not on record	77
Oulu, FI	65
SLU Artdatabankenlocation not on record	34
Stockholm, SE	31
ZMAAlocation not on record	26
Tromsø, NO	22
Champaign, US	17
ZSMlocation not on record	14
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
Toronto, CA	9
Bavarian State Collection of Zoologylocation not on record	9
Zürich, CH	7
Institute of Zoology Slovak Academy of Scienceslocation not on record	5
OSUClocation not on record	5
Helsinki, FI	4
Edmonton, CA	4
University of Oslo, Natural History Museumlocation not on record	3
Tilburg, NL	3
University of Oulu, Zoological Museumlocation not on record	3
NEFlocation not on record	2
University of Oululocation not on record	2
Washington State Department of Agriculturelocation not on record	2
neflocation not on record	2
DFlocation not on record	1
University of Guelphlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1
NCMGlocation not on record	1
Vancouver, CA	1

30 institutions · 469 of 583 vouchered records shown · 114 without an institution code

09Environmental DNA303 detections

Where the DNA of Ametastegia pallipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found303

Studies independent surveys4

Countries13

Verifiable raw sequence linked192

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 303 detections have coordinates

Open the map13 countries0

1. Forest & Woodland|1.1. Boreal Forest1. Forest & WoodlandMixed forest on sandy soilBog edge in alpine birch forestChablis chenaie14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 10.5–17.0

Seasonal swing summer↔winter18.4 °C

Max temp (day)18.9 °C 13.1–20.9

Min temp (night)11.8 °C 5.90–13.8

Precipitation73.8 mm/mo 56.0–103

Air humidity60.6 % 57.1–63.8

Moisture balance-35.4 mm/mo -57.8–12.3

Vapour deficit686 Pa 479–762

Wind speed3.50 m/s 2.20–4.30

Cloud cover50.0 % 40.5–60.1

CHELSA 1981–2010, ~9 km grid, at location & month of 302 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)