Ametastegia tenera

(Fallén, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Ametastegia

At a glance

Occurrence records1 631

Data sources7

Biological traits0

DNA specimens88

eDNA detections261

Sources7 archives

Databases and archives Ametastegia tenera's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 631 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI261 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics88 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 631 records

Environmental DNA4 datasets · 14 countries261 detections

DNA & barcodingBOLD88 specimens

01Narrative

Ametastegia tenera ist eine Blattwespe aus der Unterfamilie Allantinae. Die Art wurde von dem schwedischen Entomologen Carl Fredrik Fallén im Jahr 1808 als Tenthredo tenera erstbeschrieben.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding88 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ametastegia tenera has left across the world's sequence archives.

At a glance

DNA specimens88

BINs3

Marker genes1

eDNA detections261

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus73 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

2Tmostly conserved

11Tmostly conserved

17Tmostly conserved

41Avariable

42Tmostly conserved

77Tmostly conserved

96Gmostly conserved

108Amostly conserved

116Cvariable

125Cvariable

131Cmostly conserved

182Amostly conserved

203Tmostly conserved

210Tmostly conserved

215Amostly conserved

218Tmostly conserved

265Tmostly conserved

272Tmostly conserved

289Tmostly conserved

293Amostly conserved

317Amostly conserved

341Tvariable

344Amostly conserved

359Tmostly conserved

362Amostly conserved

365Tmostly conserved

399Tmostly conserved

404Tmostly conserved

405Tmostly conserved

419Tmostly conserved

431Amostly conserved

446Tmostly conserved

457Tmostly conserved

467Amostly conserved

470Tmostly conserved

472Amostly conserved

483Tmostly conserved

498Tmostly conserved

505Tmostly conserved

537Cvariable

542Amostly conserved

551Tvariable

560Amostly conserved

572Avariable

576Cmostly conserved

583Cmostly conserved

584Amostly conserved

587Tmostly conserved

614Cvariable

619Cmostly conserved

623Amostly conserved

629Amostly conserved

644Cvariable

651Cmostly conserved

CTTTATATTTTATTTTTGGATTTTGATCAGGAATATTAGGATTATCATTTAGAATATTAATTCGAACTGAATTAGGTATACCTGGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes17

BINs3

Most divergent pair6.7%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia apertasame genus4.9%Ametastegia carpinisame genus5.2%Ametastegia recenssame genus5.3%Ametastegia pulchellasame genus5.6%Ametastegia articulatasame genus6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 631 records

Wild obs. + sensor317

Museum / vouchered1 314

Range

Area of Occupancy AOO2 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 114≤1 km 44≤10 km 100

258 georeferenced · 59 without coordinates

Open the mapobservation + sensor317

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 1 011≤1 km 40≤10 km 47

1 098 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence1 314

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZMAAlocation not on record	244
NHMOlocation not on record	167
BioFokuslocation not on record	87
SLU Artdatabankenlocation not on record	34
University of Central Floridalocation not on record	27
Tilburg, NL	21
Oulu, FI	16
Stockholm, SE	13
OSUClocation not on record	10
ZSMlocation not on record	10
neflocation not on record	10
Zürich, CH	8
Tromsø, NO	6
Institute of Zoology Slovak Academy of Scienceslocation not on record	6
MZLUlocation not on record	5
Bavarian State Collection of Zoologylocation not on record	3
Helsinki, FI	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
DFFW2018location not on record	2
Gothenburg, SE	1
University of Guelphlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Washington State Department of Agriculturelocation not on record	1

23 institutions · 677 of 1 314 vouchered records shown · 637 without an institution code

09Environmental DNA261 detections

Where the DNA of Ametastegia tenera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found261

Studies independent surveys4

Countries14

Verifiable raw sequence linked189

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 261 detections have coordinates

Open the map14 countries0

Lindeskog i bratt rasskraning, noe eik, hass…Lokaliteten er et kulturlandskap. Flere smÃ¥…5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…Lokaliteten er en rik eng under gjengroing, …Hay meadowForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 10.2–17.0

Seasonal swing summer↔winter18.5 °C

Max temp (day)18.5 °C 13.2–20.9

Min temp (night)10.6 °C 5.70–13.4

Precipitation79.7 mm/mo 52.2–112

Air humidity60.1 % 57.9–62.1

Moisture balance-33.7 mm/mo -58.4–17.2

Vapour deficit668 Pa 511–762

Wind speed2.90 m/s 2.20–3.90

Cloud cover49.5 % 38.2–56.7

CHELSA 1981–2010, ~9 km grid, at location & month of 261 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ametastegia tenera

At a glance

Sources7 archives

At a glance

Record type1 631 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 631 records