Ametastegia carpini

(Hartig, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Ametastegia

At a glance

Occurrence records1 964

Data sources6

Biological traits0

DNA specimens239

eDNA detections453

Sources6 archives

Databases and archives Ametastegia carpini's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 964 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI453 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics239 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 964 records

Environmental DNA4 datasets · 13 countries453 detections

DNA & barcodingBOLD239 specimens

01Narrative

Ametastegia carpini est une espèce d'insectes de l'ordre des hyménoptères, de la famille des Tenthredinidae et du genre Ametastegia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding239 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ametastegia carpini has left across the world's sequence archives.

At a glance

DNA specimens239

BINs1

Marker genes1

eDNA detections453

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus236 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

37Amostly conserved

76Amostly conserved

85Avariable

214Gmostly conserved

280Amostly conserved

316Gmostly conserved

358Cmostly conserved

430Gvariable

514Avariable

559Gmostly conserved

598Tmostly conserved

619Amostly conserved

622Gmostly conserved

625Amostly conserved

643Tvariable

CTTATATTTTATTTTCGGATTTTGATCAGGAATATTAGGGTTATCATTTAGAATATTAATTCGAACTGAATTAGGAATACCTGGATCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 45 variants.

Diversity (π)1.4%

Haplotypes45

BIN1

Most divergent pair22.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia apertasame genus4.9%Ametastegia tenerasame genus5.2%Ametastegia pulchellasame genus6.1%Ametastegia recenssame genus6.3%Ametastegia articulatasame genus6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 964 records

Wild obs. + sensor461

Museum / vouchered1 503

Range

Area of Occupancy AOO2 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 207≤1 km 55≤10 km 102>10 km 1

365 georeferenced · 96 without coordinates

Open the mapobservation + sensor461

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 890≤1 km 96≤10 km 95>10 km 1

1 082 georeferenced · 421 without coordinates

Open the institutions mapphysical evidence1 503

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	893
Oulu, FI	135
BioFokuslocation not on record	132
ZMAAlocation not on record	60
Stockholm, SE	26
SLU Artdatabankenlocation not on record	25
Tromsø, NO	22
ZSMlocation not on record	14
Helsinki, FI	12
Institute of Zoology Slovak Academy of Scienceslocation not on record	7
Philadelphia, US	7
Zürich, CH	4
neflocation not on record	4
University of Oululocation not on record	3
DFlocation not on record	2
NEFlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
MZLUlocation not on record	2
DFFW2018location not on record	1
Tilburg, NL	1
Natural History Museum Rotterdamlocation not on record	1
South Kensington, GB	1

22 institutions · 1 356 of 1 503 vouchered records shown · 147 without an institution code

09Environmental DNA453 detections

Where the DNA of Ametastegia carpini was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found453

Studies independent surveys4

Countries13

Verifiable raw sequence linked194

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 453 detections have coordinates

Open the map13 countries0

Hay meadowUrbanBog edge in alpine birch forestForest edge (suburban)1. Forest & Woodland | 1.4. Temperate Forest1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 9.00–17.6

Seasonal swing summer↔winter22.0 °C

Max temp (day)17.1 °C 11.9–21.8

Min temp (night)8.80 °C 5.00–13.8

Precipitation72.2 mm/mo 43.5–121

Air humidity58.8 % 56.1–62.1

Moisture balance-36.8 mm/mo -64.7–27.3

Vapour deficit657 Pa 453–828

Wind speed2.70 m/s 2.10–4.10

Cloud cover48.3 % 36.7–59.0

CHELSA 1981–2010, ~9 km grid, at location & month of 452 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ametastegia carpini

At a glance

Sources6 archives

At a glance

Record type1 964 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 964 records