Amblyomma varium

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records44

Data sources5

Biological traits0

DNA specimens10

eDNA detections38

Sources5 archives

Databases and archives Amblyomma varium's data was compiled from.

GBIFGlobal Biodiversity Information Facility44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF44 records

Environmental DNA1 datasets · 3 countries38 detections

DNA & barcodingBOLD10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma varium has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections38

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes2

BIN1

Most divergent pair1.7%

Where individuals differ — all 28 variable positions, in barcode order

1Avariable

28Gmostly conserved

34Gmostly conserved

64Tmostly conserved

79Cmostly conserved

136Cmostly conserved

170Amostly conserved

187Tmostly conserved

197Cmostly conserved

202Amostly conserved

212Tmostly conserved

280Amostly conserved

283Cvariable

295Cvariable

355Cmostly conserved

361Amostly conserved

364Cmostly conserved

373Avariable

376Tmostly conserved

397Tmostly conserved

439Tmostly conserved

460Tmostly conserved

532Tmostly conserved

539Tmostly conserved

557Tvariable

625Gvariable

628Tmostly conserved

646Tvariable

AACAATATACTTGATTTTTGGAAGATGGGCAGGGATAATAGGTTTATCTATAAGAATTTTAATTCGTATAGAACTTGGCCAACCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma naponensesame genus13.0%Amblyomma geoemydaesame genus14.1%Amblyomma nodosumsame genus14.3%Amblyomma dissimilesame genus15.2%Rhipicephalus turanicussame family15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type44 records

Wild obs. + sensor7

Museum / vouchered36

Other1

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 1>10 km 3

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	17
Harold Winfred Manter Laboratory of Parasitologylocation not on record	7
Cambridge, US	1
National Biodiversity Institute, Costa Ricalocation not on record	1
Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record	1

5 institutions · 27 of 36 vouchered records shown · 9 without an institution code

09Environmental DNA38 detections

Where the DNA of Amblyomma varium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map3 countries0

Myrmeciza exsul1. Forest & Woodland|1.6. Subtropical/Tropic…Bradypus variegatusGymnopithys leucaspis

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 23.5–26.1

Seasonal swing summer↔winter1.00 °C

Max temp (day)27.7 °C 25.9–29.0

Min temp (night)23.6 °C 21.1–24.2

Precipitation323 mm/mo 209–394

Air humidity70.2 % 67.0–76.5

Moisture balance216 mm/mo 75.1–294

Vapour deficit943 Pa 675–1,061

Wind speed1.40 m/s 1.10–4.40

Cloud cover38.7 % 30.0–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)