Amblyomma nodosum

Neumann, 1899 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records30

Data sources7

Biological traits0

DNA specimens8

eDNA detections43

Sources7 archives

Databases and archives Amblyomma nodosum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 3 countries43 detections

DNA & barcodingBOLD8 specimens

01Narrative

Amblyomma nodosum is a species of specialized tick, found in three roadkilled giant anteaters from Minas Gerais, Brazil. There are 100 species of Amblyomma worldwide, 33 of which are from Brazil. A. nodosum is a specialist that lives exclusively on the giant anteater (Myrmecophaga tridactyla) and the Southern tamandua (Tamandua tetradactyla).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma nodosum has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections43

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

53Amostly conserved

54Gmostly conserved

55Amostly conserved

60Tmostly conserved

79Cmostly conserved

88Gmostly conserved

100Tmostly conserved

175Amostly conserved

212Tmostly conserved

218Gmostly conserved

240Gmostly conserved

255Gmostly conserved

271Tmostly conserved

274Amostly conserved

287Tmostly conserved

308Gmostly conserved

317Gmostly conserved

330Gmostly conserved

343Amostly conserved

361Amostly conserved

383Gmostly conserved

401Tmostly conserved

441Amostly conserved

488Gmostly conserved

565Tmostly conserved

GACAATATATTTAATTTTTGGAAGATGAGCTGGAATGGTAGGTCTTTCTATAAGAATATTAATTCGAATAGAACTTGGCCAACCTGGGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes4

BIN1

Most divergent pair0.91%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma calcaratumsame genus11.4%Amblyomma dissimilesame genus12.7%Amblyomma rotundatumsame genus13.5%Amblyomma scutatumsame genus13.5%Amblyomma latumsame genus14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor7

Museum / vouchered23

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 4 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad de Caldas (UCaldas)location not on record	5
UFMG-CCTlocation not on record	3
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	3
Harold Winfred Manter Laboratory of Parasitologylocation not on record	2
Frankfurt am Main	2
Mexico City, MX	1
Ciudad de México, MX	1

7 institutions · 17 of 23 vouchered records shown · 6 without an institution code

09Environmental DNA43 detections

Where the DNA of Amblyomma nodosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map3 countries0

Thamnophilus atrinuchaThryothorus nigricapillusVanellus chilensisArremonops conirostrisTaraba majorMyrmeciza exsul

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 24.5–26.7

Seasonal swing summer↔winter1.00 °C

Max temp (day)29.1 °C 27.6–29.9

Min temp (night)23.8 °C 21.3–24.0

Precipitation164 mm/mo 20.5–310

Air humidity64.0 % 61.6–73.2

Moisture balance32.9 mm/mo -135–191

Vapour deficit1,154 Pa 873–1,318

Wind speed1.60 m/s 1.00–2.70

Cloud cover20.5 % 12.5–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)