Amblyomma rotundatum

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records47

Data sources6

Biological traits0

DNA specimens8

eDNA detections7

Sources6 archives

Databases and archives Amblyomma rotundatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD8 specimens

01Narrative

Amblyomma rotundatum (лат.) — вид клещей рода Amblyomma из семейства Ixodidae. Центральная и Южная Америка: Мексика, Гватемала, Коста-Рика, Панама, Колумбия, Венесуэла, Французская Гвиана, Суринам, Перу, Парагвай, Бразилия, Аргентина, острова Ямайка, Гваделупа, Мартиника, Гренада и Тринидад. Этот вид был интродуцирован во Флориду (США). Все стадии развития паразитируют на лягушках и рептилиях, но предпочитают тростниковую жабу Агу. Партеногенетический вид. Жизненный цикл может быть как с одним хозяином, так и с двумя, и с тремя. Вид был впервые описан в 1844 году немецким энтомологом и арахнологом Карлом Людвигом Кохом. Переносчики риккетсий Rickettsia bellii.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma rotundatum has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections7

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 1 variable positions, in barcode order

2Amostly conserved

AATATATTTAATTTTTGGAAGGTGAGCTGGTATCCTAGGTCTTGCAATAAGAATATTAATTCGAATAGAATTAGGACAACCAGGCACTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma dissimilesame genus9.3%Amblyomma scutatumsame genus9.9%Amblyomma nodosumsame genus13.5%Amblyomma sabaneraesame genus14.3%Amblyomma imitatorsame genus14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type47 records

Wild obs. + sensor23

Museum / vouchered24

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 5≤1 km 3≤10 km 3>10 km 9

20 georeferenced · 3 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ciudad de México, MX	15
UFMG-CCTlocation not on record	3
Harold Winfred Manter Laboratory of Parasitologylocation not on record	2
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Frankfurt am Main	1

6 institutions · 23 of 24 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Amblyomma rotundatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 13.5–25.3

Seasonal swing summer↔winter9.50 °C

Max temp (day)25.3 °C 16.8–29.6

Min temp (night)16.4 °C 9.90–22.1

Precipitation145 mm/mo 41.3–293

Air humidity62.5 % 51.1–69.6

Moisture balance7.40 mm/mo -99.8–157

Vapour deficit918 Pa 673–1,088

Wind speed2.40 m/s 1.00–5.40

Cloud cover39.2 % 31.7–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)