Amblyomma dissimile

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records384

Data sources8

Biological traits0

DNA specimens50

eDNA detections50

Sources8 archives

Databases and archives Amblyomma dissimile's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility384 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF384 records

Environmental DNA1 datasets · 7 countries50 detections

DNA & barcodingBOLD50 specimens

Genome at a glanceGoaT · TreeOfSex2n = 22

01Narrative

Amblyomma dissimile (лат.) — вид клещей рода Amblyomma из семейства Ixodidae. Западное полушарие: от США (Флорида) и Мексики до Аргентины. Острова Карибского бассейна: Антигуа, Барбадос, Гаити, Гренада, Куба, Тринидад и Тобаго. Взрослые стадии паразитируют на пресмыкающихся и земноводных. Личинки реже живут на рептилиях, но чаще обнаруживаются на других видах хозяев, включая млекопитающих и птиц. Обычный вид, инфестирующий, например, в Панаме, 60% змей, 72% жаб и 84% игуан. Вид был впервые описан в 1844 году немецким энтомологом и арахнологом Карлом Людвигом Кохом.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma dissimile has left across the world's sequence archives.

At a glance

DNA specimens50

BINs4

Marker genes2

eDNA detections50

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

21Amostly conserved

28Tmostly conserved

30Tmostly conserved

33Amostly conserved

34Amostly conserved

36Tmostly conserved

37Cmostly conserved

46Gmostly conserved

48Tmostly conserved

58Tmostly conserved

87Amostly conserved

105Tmostly conserved

174Gmostly conserved

237Cmostly conserved

249Cmostly conserved

270Cmostly conserved

277Tmostly conserved

282Cvariable

285Amostly conserved

297Tmostly conserved

301Tmostly conserved

342Cmostly conserved

345Cmostly conserved

363Tmostly conserved

372Gmostly conserved

378Tmostly conserved

399Tmostly conserved

400Tmostly conserved

402Amostly conserved

406Cmostly conserved

417Tmostly conserved

420Amostly conserved

432Tmostly conserved

435Tmostly conserved

438Cmostly conserved

448Amostly conserved

489Gmostly conserved

495Cmostly conserved

498Cvariable

525Tmostly conserved

532Tmostly conserved

555Cmostly conserved

577Tmostly conserved

597Cmostly conserved

606Tmostly conserved

612Tmostly conserved

618Tmostly conserved

622Gmostly conserved

624Avariable

630Gmostly conserved

633Cmostly conserved

645Cmostly conserved

ACAATATATTTAATTTTTGGAAGATGATCTGGAATTCTAGGACTTGCTATAAGAATATTAATTCGAATAGAATTAGGCCAACCAGGAACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes13

BINs4

Most divergent pair10.1%

N.AmericaS.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma scutatumsame genus5.9%Amblyomma rotundatumsame genus9.3%Amblyomma calcaratumsame genus11.9%Amblyomma imitatorsame genus12.3%Amblyomma geoemydaesame genus12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_085535 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND1ND5ND4ND4LND6CYTB16S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Amblyomma dissimile carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Norton, R. A., J. B. Kethley, D. E. Johnston, and B. M. O'Connor. 1993. Phylogenetic perspectives on genetic systems and reproductive modes of mites. Pp. 8-99 in D. L. Wrensch and M. A. Ebbert, Evolution and diversity of sex ratio in insects and mites, Springer. ↗

08Occurrence & distribution

Record type384 records

Wild obs. + sensor68

Museum / vouchered316

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 17≤1 km 7≤10 km 1>10 km 8

33 georeferenced · 35 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 44≤1 km 6≤10 km 9>10 km 1

60 georeferenced · 256 without coordinates

Open the institutions mapphysical evidence316

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ciudad de México, MX	132
Mexico City, MX	77
Harold Winfred Manter Laboratory of Parasitologylocation not on record	48
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	31
Champaign, US	11
Cambridge, US	3
Provo, US	2
New Haven, US	2
UFMG-CCTlocation not on record	1
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	1
Essig Museum of Entomologylocation not on record	1

11 institutions · 309 of 316 vouchered records shown · 7 without an institution code

09Environmental DNA50 detections

Where the DNA of Amblyomma dissimile was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map7 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…Bufo marinus

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 25.6–26.2

Seasonal swing summer↔winter3.60 °C

Max temp (day)29.6 °C 26.9–29.6

Min temp (night)22.3 °C 22.3–24.9

Precipitation222 mm/mo 78.3–333

Air humidity64.7 % 64.7–70.1

Moisture balance67.7 mm/mo -108–228

Vapour deficit1,175 Pa 1,008–1,230

Wind speed2.60 m/s 1.20–5.60

Cloud cover68.7 % 16.0–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)