Amblyomma calcaratum

Neumann, 1899 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records12

Data sources6

Biological traits0

DNA specimens8

eDNA detections18

Sources6 archives

Databases and archives Amblyomma calcaratum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD8 specimens

01Narrative

Amblyomma calcaratum (лат.) — вид клещей из семейства Ixodidae. Неотропика. Центральная Америка: Мексика, Белиз, Коста-Рика, Панама. Южная Америка: Аргентина, Боливия, Бразилия, Венесуэла, Гайана, Колумбия, Парагвай, Перу, Суринам, Тринидад и Тобаго, Эквадор. Среднего размера клещи. Длина капитулума самцов 1,0 мм. Длина скутума самок 2,25 мм. Тазики I с 2 длинными шпорами, тазики II—IV с одной шпорой. У самцов спинной жесткий щиток прикрывает все тело, у самок треть. Паразитируют на млекопитающих, главным образом, на муравьедах: четырёхпалые муравьеды (Tamandua) и гигантский муравьед (Myrmecophaga). Личинки и нимфы также найдены на птицах. Известны случаи обнаружения на ленивцах, оленях, собаках и других животных. Вид был впервые описан в 1899 году французским зоологом профессором Л. Г. Ньюманном.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma calcaratum has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.13%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

202Cmostly conserved

340Cmostly conserved

361Amostly conserved

TACAATATATTTAATTTTCGGAAGATGAGCTGGAATAATAGGCTTGTCCATAAGAATATTAATTCGAATAGAACTTGGCCAACCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma nodosumsame genus11.4%Amblyomma geoemydaesame genus11.9%Amblyomma dissimilesame genus11.9%Amblyomma pacaesame genus13.1%Amblyomma imitatorsame genus13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type12 records

Wild obs. + sensor4

Museum / vouchered8

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	1
Frankfurt am Main	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Ciudad de México, MX	1

4 institutions · 4 of 8 vouchered records shown · 4 without an institution code

09Environmental DNA18 detections

Where the DNA of Amblyomma calcaratum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

Tamandua mexicana

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 23.5–26.0

Seasonal swing summer↔winter1.00 °C

Max temp (day)28.3 °C 25.9–29.4

Min temp (night)23.1 °C 21.2–23.8

Precipitation192 mm/mo 26.3–321

Air humidity70.2 % 62.4–74.7

Moisture balance66.7 mm/mo -125–198

Vapour deficit943 Pa 738–1,268

Wind speed2.10 m/s 0.9–2.70

Cloud cover24.9 % 12.2–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)