Amblyomma geoemydae

Cantor, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records229

Data sources7

Biological traits0

DNA specimens15

eDNA detections0

Sources7 archives

Databases and archives Amblyomma geoemydae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF229 records

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT · NCBI≈1.8 Gbp

01Narrative

Amblyomma geoemydae (лат.) — вид клещей рода Amblyomma из семейства Ixodidae. Южная и Восточная Азия: Индия, Таиланд, Камбоджа, Малайзия, Вьетнам, Индонезия, Филиппины, Китай и Япония (Рюкю). Основными хозяевами на всех этапах развития являются сухопутные черепахи. Нимфы были найдены на птицах. Вид был впервые описан в 1847 году датским зоологом Теодором Эдвардом Кантором.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma geoemydae has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P672 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.87%

Haplotypes1

BIN1

Where individuals differ — all 15 variable positions, in barcode order

44Tmostly conserved

49Tmostly conserved

62Amostly conserved

193Cvariable

208Tvariable

232Cvariable

244Tvariable

280Tvariable

340Cvariable

502Tvariable

559Amostly conserved

604Tvariable

622Cmostly conserved

634Avariable

664Cmostly conserved

TATTGGAACAATATATTTAATTTTCGGAAGATGAGCTGGAATTTTAGGTTTATCTATAAGAATTTTAATTCGAATAGAACTAGGTCAACC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma integrumsame genus1.7%Amblyomma testudinariumsame genus8.5%Amblyomma calcaratumsame genus11.9%Amblyomma latumsame genus12.0%Amblyomma dissimilesame genus12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amblyomma geoemydae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 790 569 056 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amblyomma geoemydae1.79 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type229 records

Wild obs. + sensor7

Museum / vouchered222

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 3>10 km 3

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 104

104 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence222

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	117
New Haven, US	104
Harold Winfred Manter Laboratory of Parasitologylocation not on record	1

3 institutions · 222 of 222 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)