Amblyomma testudinarium

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records1 040

Data sources10

Biological traits0

DNA specimens50

eDNA detections50

Sources10 archives

Databases and archives Amblyomma testudinarium's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 040 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 040 records

Environmental DNA1 datasets · 2 countries50 detections

DNA & barcodingBOLD50 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈2.7 Gbp

01Narrative

Amblyomma testudinarium is a hard-bodied tick of the genus Amblyomma. It is found in Indonesia, India, Japan, Thailand, Sri Lanka and Vietnam. Adults parasitize various larger mammals such as buffalo and cattle, whereas nymphs and larvae use mostly larger and medium mammals.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma testudinarium has left across the world's sequence archives.

At a glance

DNA specimens50

BINs4

Marker genes1

eDNA detections50

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P666 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 103 variable positions, in barcode order

21Tmostly conserved

36Tmostly conserved

48Tmostly conserved

50Gmostly conserved

51Amostly conserved

55Amostly conserved

56Tmostly conserved

66Cmostly conserved

91Tmostly conserved

94Gmostly conserved

96Cmostly conserved

102Amostly conserved

123Cmostly conserved

132Cmostly conserved

144Gmostly conserved

150Tmostly conserved

156Amostly conserved

162Tmostly conserved

174Tmostly conserved

180Tmostly conserved

198Amostly conserved

201Amostly conserved

219Tmostly conserved

222Tmostly conserved

229Cmostly conserved

234Amostly conserved

237Tmostly conserved

240Tmostly conserved

249Tmostly conserved

252Cmostly conserved

255Tmostly conserved

285Cmostly conserved

288Tmostly conserved

291Tmostly conserved

299Gmostly conserved

301Tmostly conserved

304Tmostly conserved

306Amostly conserved

307Amostly conserved

311Amostly conserved

315Tmostly conserved

318Tmostly conserved

330Amostly conserved

335Tmostly conserved

336Tmostly conserved

342Tmostly conserved

351Tmostly conserved

354Tmostly conserved

357Tmostly conserved

360Amostly conserved

363Tmostly conserved

372Tmostly conserved

376Cmostly conserved

378Tmostly conserved

381Tmostly conserved

399Tmostly conserved

417Amostly conserved

418Tmostly conserved

420Amostly conserved

424Tmostly conserved

429Tmostly conserved

432Tmostly conserved

435Amostly conserved

438Tmostly conserved

450Amostly conserved

468Tmostly conserved

471Tmostly conserved

475Gvariable

477Amostly conserved

486Tmostly conserved

489Tmostly conserved

495Tmostly conserved

501Cmostly conserved

502Amostly conserved

510Tmostly conserved

513Amostly conserved

516Amostly conserved

525Amostly conserved

528Amostly conserved

531Tmostly conserved

534Amostly conserved

539Cmostly conserved

540Amostly conserved

550Cmostly conserved

552Tmostly conserved

555Cmostly conserved

564Tmostly conserved

567Gmostly conserved

573Amostly conserved

574Tmostly conserved

576Amostly conserved

579Amostly conserved

582Tmostly conserved

585Tmostly conserved

603Amostly conserved

615Tmostly conserved

621Tmostly conserved

627Tmostly conserved

639Tmostly conserved

642Amostly conserved

645Tmostly conserved

648Gmostly conserved

651Tmostly conserved

AATCATAAAGACATTGGAACTATATATTTAATTTTTGGAAGATGAGCTGGAATTATAGGCTTATCCATAAGAATTTTAATTCGAATAGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes13

BINs4

Most divergent pair16.2%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma integrumsame genus7.9%Amblyomma geoemydaesame genus8.5%Amblyomma variegatumsame genus13.2%Amblyomma latumsame genus13.6%Haemaphysalis danielisame family13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_062071 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND1ND5ND4ND4LND6CYTB16S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Amblyomma testudinarium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 690 779 535 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amblyomma testudinarium2.69 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Norton, R. A., J. B. Kethley, D. E. Johnston, and B. M. O'Connor. 1993. Phylogenetic perspectives on genetic systems and reproductive modes of mites. Pp. 8-99 in D. L. Wrensch and M. A. Ebbert, Evolution and diversity of sex ratio in insects and mites, Springer. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type1 040 records

Wild obs. + sensor25

Museum / vouchered1 015

Range

Area of Occupancy AOO792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 8≤1 km 1≤10 km 5>10 km 3

17 georeferenced · 8 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 015 records without

Open the institutions mapphysical evidence1 015

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	946
Harold Winfred Manter Laboratory of Parasitologylocation not on record	8

2 institutions · 954 of 1 015 vouchered records shown · 32 without an institution code

09Environmental DNA50 detections

Where the DNA of Amblyomma testudinarium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 10.9–24.4

Seasonal swing summer↔winter21.0 °C

Max temp (day)19.5 °C 13.0–26.4

Min temp (night)11.0 °C 7.40–22.7

Precipitation172 mm/mo 17.3–345

Air humidity60.5 % 41.3–69.0

Moisture balance66.5 mm/mo -155–303

Vapour deficit810 Pa 591–1,240

Wind speed3.90 m/s 1.80–6.20

Cloud cover34.8 % 29.1–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amblyomma testudinarium

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 040 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 040 records