Amblyomma variegatum

Fabricius, 1794 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records415

Data sources7

Biological traits0

DNA specimens175

eDNA detections177

Sources7 archives

Databases and archives Amblyomma variegatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility415 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI177 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics175 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF415 records

Environmental DNA1 datasets · 9 countries177 detections

DNA & barcodingBOLD175 specimens

01Narrative

Amblyomma variegatum, commonly known as the tropical bont tick, is a species of tick of the genus Amblyomma endemic to Africa. It has spread from its centre of origin to several countries, including the Caribbean islands, where it is known as the Senegalese tick (due to the suspected introduction of the tick from cattle imports from that country) and the Antigua gold tick. They are vividly coloured (especially the males) and have a substantial impact on livestock, primarily through their transmission of diseases. They are three-host hard ticks (where each life stage completes a blood meal on a particular host before dropping off and ecdysis) that have been found on a variety of domesticated species such camels, cattle, goats, sheep, dogs, and various species of wildlife.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding175 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma variegatum has left across the world's sequence archives.

At a glance

DNA specimens175

BINs4

Marker genes2

eDNA detections177

Countries18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P615 bp consensus170 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

12Tvariable

72Avariable

78Tmostly conserved

162Avariable

178Amostly conserved

189Avariable

204Tvariable

264Amostly conserved

297Cmostly conserved

321Cvariable

327Avariable

333Tmostly conserved

342Avariable

345Tmostly conserved

393Avariable

441Tmostly conserved

477Cvariable

486Tvariable

489Avariable

504Amostly conserved

511Tvariable

517Tvariable

519Avariable

537Amostly conserved

556Tmostly conserved

582Avariable

597Tvariable

609Gvariable

612Tmostly conserved

AGCTGAGCAGGTATTTCAGGGTTGTCAATAAGAATTTTAATTCGAATAGAACTAGGCCAACCAGGAACATTAATTGGTAATGACCAAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes31

BINs4

Most divergent pair4.7%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma cohaerenssame genus9.2%Amblyomma gemmasame genus12.8%Amblyomma hebraeumsame genus13.2%Amblyomma testudinariumsame genus13.2%Haemaphysalis bispinosasame family14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type415 records

Wild obs. + sensor33

Museum / vouchered382

Range

Area of Occupancy AOO616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 7≤1 km 5≤10 km 3>10 km 15

30 georeferenced · 3 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 380 without coordinates

Open the institutions mapphysical evidence382

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Museum for Central Africalocation not on record	251
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	17
Harold Winfred Manter Laboratory of Parasitologylocation not on record	8
Cambridge, US	3
Cape Town, ZA	3

5 institutions · 282 of 382 vouchered records shown · 100 without an institution code

09Environmental DNA177 detections

Where the DNA of Amblyomma variegatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found177

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 177 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 20.9–27.7

Seasonal swing summer↔winter4.60 °C

Max temp (day)28.2 °C 25.0–33.2

Min temp (night)19.4 °C 15.4–22.6

Precipitation121 mm/mo 44.9–305

Air humidity59.6 % 50.2–68.2

Moisture balance-29.7 mm/mo -122–167

Vapour deficit1,188 Pa 841–1,630

Wind speed2.00 m/s 1.40–3.40

Cloud cover32.2 % 16.6–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)