Amblyomma cohaerens

Dönitz, 1909 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records124

Data sources6

Biological traits0

DNA specimens5

eDNA detections4

Sources6 archives

Databases and archives Amblyomma cohaerens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility124 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF124 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

Amblyomma cohaerens (лат.) — вид клещей рода Amblyomma из семейства Ixodidae. Африка: Бурунди, Заир, Кения, Руанда, Судан, Танзания, Уганда, Эфиопия. Паразитируют на млекопитающих, главным образом, на крупном рогатом скоте и диких буйволах. Изредка встречаются и на других диких копытных. Незрелые клещи питаются на различных видах млекопитающих и птиц. В Эфиопии, максимальная активность наблюдается во время сезона дождей, и при благоприятных условиях может развиваться два поколения в год.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma cohaerens has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P611 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Diversity (π)6.3%

Haplotypes2

BINs2

Most divergent pair0.16%

Where individuals differ — all 95 variable positions, in barcode order

5Amostly conserved

7Tmostly conserved

13Cmostly conserved

16Amostly conserved

19Amostly conserved

25Tmostly conserved

27Gmostly conserved

31Amostly conserved

34Amostly conserved

40Amostly conserved

49Cmostly conserved

55Cmostly conserved

73Cmostly conserved

76Tmostly conserved

82Tmostly conserved

88Amostly conserved

91Tmostly conserved

92Amostly conserved

103Tmostly conserved

106Tmostly conserved

118Tmostly conserved

130Tmostly conserved

133Amostly conserved

145Amostly conserved

146Tmostly conserved

169Cmostly conserved

181Cmostly conserved

184Tmostly conserved

199Cmostly conserved

215Cmostly conserved

217Cmostly conserved

223Tmostly conserved

226Amostly conserved

231Gmostly conserved

232Cmostly conserved

233Tmostly conserved

235Amostly conserved

236Cvariable

238Amostly conserved

239Amostly conserved

250Tmostly conserved

254Gmostly conserved

256Amostly conserved

268Cmostly conserved

283Tmostly conserved

292Cmostly conserved

295Tmostly conserved

296Tmostly conserved

298Amostly conserved

308Cmostly conserved

310Tmostly conserved

316Cmostly conserved

322Gmostly conserved

325Amostly conserved

337Amostly conserved

340Amostly conserved

349Tmostly conserved

356Cmostly conserved

367Gmostly conserved

370Amostly conserved

377Tmostly conserved

379Amostly conserved

383Tmostly conserved

385Amostly conserved

400Amostly conserved

403Tmostly conserved

406Tmostly conserved

418Gmostly conserved

423Tmostly conserved

427Tmostly conserved

428Amostly conserved

432Cmostly conserved

433Amostly conserved

434Amostly conserved

439Gmostly conserved

445Tmostly conserved

466Tmostly conserved

469Gvariable

471Cmostly conserved

476Amostly conserved

479Amostly conserved

481Tmostly conserved

487Cmostly conserved

496Cmostly conserved

497Cmostly conserved

499Tmostly conserved

511Amostly conserved

517Tmostly conserved

520Cmostly conserved

538Cmostly conserved

553Amostly conserved

556Amostly conserved

568Amostly conserved

571Amostly conserved

574Gmostly conserved

AAGAATTTTAATCCGAATAGAACTTGGACAACCAGGAACATTAATTGGCAATGACCAAATTTATAATGTAATCGTTACAGCTCATGCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma variegatumsame genus9.2%Amblyomma gemmasame genus11.3%Amblyomma lepidumsame genus11.9%Amblyomma eburneumsame genus12.5%Amblyomma auriculariumsame genus13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type124 records

Wild obs. + sensor3

Museum / vouchered121

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤1 km 12≤10 km 1>10 km 1

14 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Museum for Central Africalocation not on record	100
New Haven, US	12
Cambridge, US	4
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	3

4 institutions · 119 of 121 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Amblyomma cohaerens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)