Amblyomma auricularium

Conil, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records12

Data sources6

Biological traits0

DNA specimens16

eDNA detections4

Sources6 archives

Databases and archives Amblyomma auricularium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD16 specimens

01Narrative

Amblyomma auricularium (лат.) — вид клещей из семейства Ixodidae. Неотропика и Неарктика. Центральная Америка, известны случаи обнаружения в Северной Америке: США, Мексика. Южная Америка: Аргентина, Боливия, Бразилия, Венесуэла, Гайана, Колумбия, Парагвай, Тринидад и Тобаго, Уругвай. Среднего размера клещи. Тазики I с 2 шпорами, тазики II—IV с одной шпорой. Все стадии развития паразитируют на броненосцах (Dasypodidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma auricularium has left across the world's sequence archives.

At a glance

DNA specimens16

BINs3

Marker genes2

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 103 variable positions, in barcode order

12Ahighly variable

13Amostly conserved

15Tvariable

18Tmostly conserved

24Amostly conserved

29Gmostly conserved

34Tmostly conserved

36Amostly conserved

41Gmostly conserved

42Avariable

45Amostly conserved

49Cvariable

52Gmostly conserved

54Cvariable

60Amostly conserved

67Tmostly conserved

70Amostly conserved

78Tmostly conserved

81Tvariable

90Tmostly conserved

93Tvariable

96Amostly conserved

99Tmostly conserved

102Tmostly conserved

108Cvariable

114Cmostly conserved

138Amostly conserved

165Tvariable

172Cmostly conserved

177Tmostly conserved

180Tmostly conserved

187Cmostly conserved

198Avariable

201Cmostly conserved

213Tmostly conserved

216Amostly conserved

225Cmostly conserved

234Cmostly conserved

238Cmostly conserved

240Tmostly conserved

241Tmostly conserved

246Cvariable

252Gvariable

258Tmostly conserved

277Cmostly conserved

280Gmostly conserved

282Gmostly conserved

288Cmostly conserved

291Amostly conserved

294Cmostly conserved

315Tmostly conserved

318Cvariable

334Cmostly conserved

336Tmostly conserved

339Tmostly conserved

343Tmostly conserved

348Tvariable

355Gmostly conserved

357Tmostly conserved

364Gmostly conserved

372Cmostly conserved

375Amostly conserved

378Tmostly conserved

390Tmostly conserved

393Amostly conserved

408Cmostly conserved

411Tmostly conserved

414Tmostly conserved

432Tmostly conserved

435Tvariable

444Cvariable

455Tmostly conserved

459Tmostly conserved

463Gmostly conserved

468Tmostly conserved

469Gmostly conserved

498Tmostly conserved

501Cmostly conserved

510Tmostly conserved

516Tmostly conserved

522Tmostly conserved

529Gmostly conserved

540Tvariable

543Cmostly conserved

546Tmostly conserved

549Cmostly conserved

553Tmostly conserved

555Amostly conserved

564Tmostly conserved

567Tvariable

570Cmostly conserved

573Cmostly conserved

585Cmostly conserved

588Cmostly conserved

591Cmostly conserved

592Cmostly conserved

594Tmostly conserved

597Amostly conserved

600Gmostly conserved

603Amostly conserved

606Amostly conserved

612Amostly conserved

621Tmostly conserved

TGAGCAGGAATAATTGGTTTATCAATAAGAATTTTAATTCGAATAGAACTAGGCCAACCAGGAACATTAATTGGAAATGATCAAATTTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.5%

Haplotypes6

BINs3

Most divergent pair12.5%

S.AmericaN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma parvumsame genus8.3%Amblyomma inornatumsame genus10.7%Amblyomma tigrinumsame genus11.9%Amblyomma cohaerenssame genus13.0%Amblyomma maculatumsame genus13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type12 records

Wild obs. + sensor4

Museum / vouchered8

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	1

1 institutions · 1 of 8 vouchered records shown · 7 without an institution code

09Environmental DNA4 detections

Where the DNA of Amblyomma auricularium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)