Amblyomma tigrinum

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records74

Data sources5

Biological traits0

DNA specimens11

eDNA detections11

Sources5 archives

Databases and archives Amblyomma tigrinum's data was compiled from.

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma tigrinum has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P603 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

58Tvariable

111Cmostly conserved

154Gmostly conserved

172Tmostly conserved

199Gmostly conserved

232Gmostly conserved

286Gmostly conserved

298Tmostly conserved

310Tmostly conserved

331Cvariable

343Tmostly conserved

424Tmostly conserved

472Amostly conserved

580Gmostly conserved

581Gmostly conserved

583Tvariable

AGTATTAAAATTTCGATCAGTTAGTAATATTGTAATAGCACCTGCTAAAACAGGTAATGATAAAAGAAGAAGAATTGTTGTAATAAAAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.84%

Haplotypes9

BIN1

Most divergent pair1.5%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma maculatumsame genus6.6%Amblyomma tristesame genus7.0%Amblyomma auriculariumsame genus11.9%Amblyomma parvumsame genus13.1%Amblyomma testudinariumsame genus13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_085540 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND1ND5ND4ND4LND6CYTB16S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type74 records

Wild obs. + sensor29

Museum / vouchered45

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 7≤1 km 4≤10 km 10>10 km 3

24 georeferenced · 5 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 45 records without

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Harold Winfred Manter Laboratory of Parasitologylocation not on record	32

1 institutions · 32 of 45 vouchered records shown · 13 without an institution code

09Environmental DNA11 detections

Where the DNA of Amblyomma tigrinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 21.8–22.3

Seasonal swing summer↔winter3.40 °C

Max temp (day)26.5 °C 26.5–27.5

Min temp (night)17.3 °C 17.0–17.6

Precipitation140 mm/mo 60.0–140

Air humidity59.3 % 54.7–59.3

Moisture balance-7.00 mm/mo -56.3–-7.00

Vapour deficit1,062 Pa 1,062–1,226

Wind speed3.60 m/s 2.30–3.60

Cloud cover44.0 % 42.0–53.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)