Amblyomma triste

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records42

Data sources5

Biological traits0

DNA specimens55

eDNA detections60

Sources5 archives

Databases and archives Amblyomma triste's data was compiled from.

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF42 records

Environmental DNA1 datasets · 4 countries60 detections

DNA & barcodingBOLD55 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma triste has left across the world's sequence archives.

At a glance

DNA specimens55

BINs2

Marker genes1

eDNA detections60

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P527 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

29Cmostly conserved

95Tmostly conserved

125Amostly conserved

140Gvariable

149Cmostly conserved

161Tmostly conserved

205Cmostly conserved

263Cmostly conserved

281Cmostly conserved

296Cmostly conserved

359Tmostly conserved

371Tmostly conserved

377Cmostly conserved

401Amostly conserved

423Tmostly conserved

444Amostly conserved

GCCAACCAGGAACATTAATTGGAAATGACCAAATTTATAATGTAATTGTTACAGCCCATGCATTTATTATAATTTTTTTTATAGTAATAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes18

BINs2

Most divergent pair3.0%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma maculatumsame genus1.5%Amblyomma tigrinumsame genus7.0%Amblyomma latumsame genus13.9%Amblyomma auriculariumsame genus14.2%Rhipicephalus rossicussame family15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_088502 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND1ND5ND4ND4LND6CYTB16S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type42 records

Wild obs. + sensor39

Museum / vouchered3

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 16≤1 km 12≤10 km 2>10 km 2

32 georeferenced · 7 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	2
US	1

2 institutions · 3 of 3 vouchered records shown

09Environmental DNA60 detections

Where the DNA of Amblyomma triste was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 16.6–26.9

Seasonal swing summer↔winter5.60 °C

Max temp (day)28.3 °C 21.3–30.4

Min temp (night)19.4 °C 12.3–23.8

Precipitation113 mm/mo 94.6–165

Air humidity59.1 % 57.7–64.8

Moisture balance-7.90 mm/mo -34.3–26.8

Vapour deficit1,196 Pa 832–1,262

Wind speed2.30 m/s 2.00–3.60

Cloud cover36.6 % 32.1–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)