Amblyomma inornatum

Banks, 1909 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records25

Data sources6

Biological traits0

DNA specimens4

eDNA detections3

Sources6 archives

Databases and archives Amblyomma inornatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT2n = 22

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma inornatum has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P532 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 82 variable positions, in barcode order

4Amostly conserved

5Tmostly conserved

6Tmostly conserved

9Cmostly conserved

15Amostly conserved

40Tmostly conserved

45Tmostly conserved

51Tmostly conserved

54Gmostly conserved

81Cmostly conserved

87Amostly conserved

99Amostly conserved

129Amostly conserved

144Tmostly conserved

147Cmostly conserved

153Tmostly conserved

156Cmostly conserved

159Cmostly conserved

165Amostly conserved

168Gmostly conserved

171Tmostly conserved

177Amostly conserved

178Tmostly conserved

180Amostly conserved

183Gmostly conserved

186Gmostly conserved

198Amostly conserved

207Amostly conserved

222Amostly conserved

237Cmostly conserved

244Tmostly conserved

246Amostly conserved

252Cmostly conserved

255Gmostly conserved

258Tmostly conserved

261Tmostly conserved

264Cmostly conserved

267Amostly conserved

268Tmostly conserved

270Amostly conserved

273Amostly conserved

276Gmostly conserved

279Tmostly conserved

291Amostly conserved

294Amostly conserved

306Tmostly conserved

309Amostly conserved

312Tmostly conserved

313Cmostly conserved

318Tmostly conserved

321Tmostly conserved

324Tmostly conserved

325Cmostly conserved

330Cmostly conserved

333Cmostly conserved

336Cmostly conserved

339Amostly conserved

345Cmostly conserved

348Tmostly conserved

352Amostly conserved

354Gmostly conserved

357Cmostly conserved

373Cmostly conserved

375Tmostly conserved

381Tmostly conserved

384Amostly conserved

387Tmostly conserved

390Amostly conserved

399Tmostly conserved

414Cmostly conserved

420Tmostly conserved

438Tmostly conserved

465Tmostly conserved

474Tmostly conserved

483Tmostly conserved

486Amostly conserved

495Amostly conserved

496Gmostly conserved

504Tmostly conserved

507Tmostly conserved

510Tmostly conserved

516Tmostly conserved

ATAATTGGCTTATCAATAAGAATTTTAATTCGAATAGAATTAGGTCAACCTGGGACATTAATTGGAAATGATCAAATTTACAATGTAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.7%

Haplotypes3

BINs2

Most divergent pair0.38%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma auriculariumsame genus10.7%Amblyomma parvumsame genus11.7%Amblyomma integrumsame genus13.2%Amblyomma maculatumsame genus13.9%Amblyomma tigrinumsame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Amblyomma inornatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type25 records

Museum / vouchered25

Range

Area of Occupancy AOO80 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Harold Winfred Manter Laboratory of Parasitologylocation not on record	19
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	2
Mexico City, MX	1
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	1

4 institutions · 23 of 25 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Amblyomma inornatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)