Amblyomma gemma

Dönitz, 1909 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records18

Data sources6

Biological traits0

DNA specimens25

eDNA detections28

Sources6 archives

Databases and archives Amblyomma gemma's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 1 countries28 detections

DNA & barcodingBOLD25 specimens

01Narrative

Amblyomma gemma (лат.) — вид клещей из семейства Ixodidae. Африка: Кения, Танзания, Сомали, Уганда, Джибути, Йемен. Паразитируют на млекопитающих, главным образом, на домашним скоте. Среди хозяев чаще, чем другие заражаются дикие млекопитающие, буйволы, жирафы и носороги. Незрелые стадии развития питаются на различных млекопитающих и птицах.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma gemma has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections28

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P591 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

9Avariable

85Tmostly conserved

86Tmostly conserved

213Cvariable

243Avariable

255Avariable

306Cvariable

504Tmostly conserved

549Cmostly conserved

567Cvariable

ATAGAACTAGGACAACCAGGGACTTTAATTGGTAATGACCAAATCTATAATGTAATTGTCACAGCTCATGCTTTTATCATAATTTTTTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes11

BIN1

Most divergent pair3.2%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma cohaerenssame genus11.3%Amblyomma hebraeumsame genus11.8%Amblyomma variegatumsame genus12.8%Amblyomma latumsame genus15.1%Hyalomma detritumsame family15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type18 records

Wild obs. + sensor4

Museum / vouchered14

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3≤10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	4
Royal Museum for Central Africalocation not on record	2
New Haven, US	1

3 institutions · 7 of 14 vouchered records shown · 7 without an institution code

09Environmental DNA28 detections

Where the DNA of Amblyomma gemma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 18.4–26.3

Seasonal swing summer↔winter2.60 °C

Max temp (day)27.4 °C 23.3–31.7

Min temp (night)16.9 °C 13.1–20.4

Precipitation46.7 mm/mo 18.4–110

Air humidity56.9 % 55.6–57.9

Moisture balance-122 mm/mo -135–-28.7

Vapour deficit1,188 Pa 909–1,487

Wind speed2.60 m/s 2.30–4.00

Cloud cover31.5 % 22.3–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)