Amblyomma hebraeum

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records222

Data sources7

Biological traits0

DNA specimens132

eDNA detections132

Sources7 archives

Databases and archives Amblyomma hebraeum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility222 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI132 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics132 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF222 records

Environmental DNA1 datasets · 1 countries132 detections

DNA & barcodingBOLD132 specimens

01Narrative

Amblyomma hebraeum, commonly known as the South African bont tick, is a species of hard tick that is native to southern Africa. They are sexually dimorphic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding132 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma hebraeum has left across the world's sequence archives.

At a glance

DNA specimens132

BINs2

Marker genes2

eDNA detections132

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P615 bp consensus129 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

549Cmostly conserved

556Cmostly conserved

564Avariable

603Amostly conserved

AGATGAGCAGGTATCTCAGGCTTATCAATAAGAATTTTAATTCGAATAGAATTAGGCCAACCAGGAACATTAATTGGTAATGACCAAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.53%

Haplotypes14

BINs2

Most divergent pair0.81%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma eburneumsame genus6.5%Amblyomma gemmasame genus11.8%Amblyomma cohaerenssame genus13.1%Amblyomma variegatumsame genus13.2%Amblyomma lepidumsame genus14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_067897 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND1ND5ND4ND4LND6CYTBrrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type222 records

Wild obs. + sensor147

Museum / vouchered75

Range

Area of Occupancy AOO652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 86≤1 km 13≤10 km 8>10 km 5

112 georeferenced · 35 without coordinates

Open the mapobservation + sensor147

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 75 records without

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	8
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	3
Harold Winfred Manter Laboratory of Parasitologylocation not on record	1

3 institutions · 12 of 75 vouchered records shown · 63 without an institution code

09Environmental DNA132 detections

Where the DNA of Amblyomma hebraeum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found132

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 132 detections have coordinates

Open the map1 country0

Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 21.0–22.6

Seasonal swing summer↔winter15.6 °C

Max temp (day)28.9 °C 28.9–29.0

Min temp (night)12.9 °C 12.9–15.8

Precipitation34.7 mm/mo 34.7–63.8

Air humidity45.7 % 45.7–51.5

Moisture balance-131 mm/mo -131–-93.6

Vapour deficit1,347 Pa 1,315–1,347

Wind speed3.30 m/s

Cloud cover16.4 % 16.4–26.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)