Amblyomma sabanerae

Stoll, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records31

Data sources5

Biological traits0

DNA specimens6

eDNA detections14

Sources5 archives

Databases and archives Amblyomma sabanerae's data was compiled from.

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma sabanerae has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

35Gmostly conserved

37Cmostly conserved

46Tmostly conserved

79Cmostly conserved

181Tmostly conserved

196Gmostly conserved

202Tmostly conserved

212Tmostly conserved

217Amostly conserved

250Tmostly conserved

340Cmostly conserved

343Tvariable

364Cmostly conserved

373Cmostly conserved

376Gmostly conserved

439Cmostly conserved

454Cmostly conserved

472Cmostly conserved

478Gmostly conserved

533Tvariable

538Gmostly conserved

631Gmostly conserved

655Cmostly conserved

AACAATATATTTAATTTTTGGAAGATGAGCTGGGGTCATAGGACTTTCAATAAGAATATTAATTCGAATAGAATTAGGCCAACCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BINs2

Most divergent pair3.3%

AsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma imitatorsame genus3.2%Amblyomma dissimilesame genus13.4%Amblyomma integrumsame genus13.8%Amblyomma geoemydaesame genus14.3%Amblyomma rotundatumsame genus14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor13

Museum / vouchered18

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 4≤1 km 3≤10 km 1>10 km 1

9 georeferenced · 4 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 1≤10 km 1>10 km 7

9 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	6
Harold Winfred Manter Laboratory of Parasitologylocation not on record	3
Mexico City, MX	3
Cambridge, US	2

4 institutions · 14 of 18 vouchered records shown · 4 without an institution code

09Environmental DNA14 detections

Where the DNA of Amblyomma sabanerae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…Phaenostictus mcleannaniRhinoclemmys annulatatropical lowland moist forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 23.5–26.3

Seasonal swing summer↔winter1.00 °C

Max temp (day)28.4 °C 26.1–29.4

Min temp (night)23.6 °C 21.1–24.0

Precipitation328 mm/mo 124–394

Air humidity70.4 % 64.8–74.6

Moisture balance196 mm/mo -36.2–260

Vapour deficit963 Pa 748–1,198

Wind speed1.50 m/s 1.00–2.30

Cloud cover36.5 % 16.9–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)