Amblyomma naponense

Packard, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records13

Data sources5

Biological traits0

DNA specimens9

eDNA detections9

Sources5 archives

Databases and archives Amblyomma naponense's data was compiled from.

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD9 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma naponense has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

10Cmostly conserved

85Cmostly conserved

91Tmostly conserved

109Gmostly conserved

118Tmostly conserved

127Amostly conserved

139Cmostly conserved

142Cmostly conserved

145Cvariable

157Cvariable

181Tmostly conserved

202Cvariable

212Tmostly conserved

226Tmostly conserved

241Tmostly conserved

250Cmostly conserved

262Amostly conserved

263Tmostly conserved

265Gvariable

287Tmostly conserved

358Tvariable

367Tmostly conserved

373Tmostly conserved

376Amostly conserved

385Cmostly conserved

388Amostly conserved

397Tmostly conserved

403Amostly conserved

415Tmostly conserved

421Cvariable

430Amostly conserved

436Cmostly conserved

445Tmostly conserved

460Tmostly conserved

478Amostly conserved

482Tmostly conserved

490Amostly conserved

499Tmostly conserved

500Tmostly conserved

547Tmostly conserved

548Tmostly conserved

578Tmostly conserved

610Tmostly conserved

613Tvariable

616Tmostly conserved

625Amostly conserved

631Amostly conserved

634Tmostly conserved

AACAATATACTTAATTTTTGGAAGTTGAGCAGGAATAATAGGTCTTTCAATAAGAATTTTAATTCGAATAGAACTTGGTCAACCCGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes4

BINs2

Most divergent pair6.6%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma tigrinumsame genus14.4%Amblyomma personatumsame genus14.5%Haemaphysalis spinigerasame family14.9%Amblyomma latumsame genus15.0%Hyalomma marginatumsame family15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_085538 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND1ND5ND4ND4LND6CYTB16S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type13 records

Wild obs. + sensor5

Museum / vouchered8

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2>10 km 3

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	2
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	1

2 institutions · 3 of 8 vouchered records shown · 5 without an institution code

09Environmental DNA9 detections

Where the DNA of Amblyomma naponense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

tropical lowland moist forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 25.7–26.0

Seasonal swing summer↔winter1.00 °C

Max temp (day)28.8 °C 28.8–30.0

Min temp (night)23.7 °C 22.3–23.7

Precipitation311 mm/mo 201–311

Air humidity71.5 % 65.4–71.5

Moisture balance182 mm/mo 66.9–182

Vapour deficit954 Pa 954–1,144

Wind speed1.80 m/s 1.20–1.80

Cloud cover43.1 % 30.7–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)