Amblyomma ovale

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records273

Data sources6

Biological traits0

DNA specimens23

eDNA detections26

Sources6 archives

Databases and archives Amblyomma ovale's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF273 records

Environmental DNA1 datasets · 6 countries26 detections

DNA & barcodingBOLD23 specimens

01Narrative

Amblyomma ovale (лат.) — вид клещей рода Amblyomma из семейства Ixodidae. Южная Америка: Бразилия, Аргентина, остров Тринидад. Обитатель плотных дождевых тропических лесов. Взрослые стадии развития в основном паразитируют на хищниках, предпочитая кошек, а также тапиров и пекари. Клещи часто встречаются на собаках, а иногда и на людях. Нимфы питаются грызунами, опоссумами, и плотоядными животными. Личинки были найдены на опоссумах и собаках. Вид был впервые описан в 1844 году немецким энтомологом и арахнологом Карлом Людвигом Кохом. Переносчики некоторых видов риккетсий (Rickettsia), уровень зараженности которыми достигает 10 %. Известны случаи прикрепления клещей к человеку.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma ovale has left across the world's sequence archives.

At a glance

DNA specimens23

BINs3

Marker genes1

eDNA detections26

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 56 variable positions, in barcode order

3Amostly conserved

7Tmostly conserved

20Tmostly conserved

24Tmostly conserved

25Cmostly conserved

27Amostly conserved

39Cmostly conserved

51Amostly conserved

57Cmostly conserved

63Gvariable

81Amostly conserved

99Cvariable

108Cmostly conserved

117Tmostly conserved

135Cmostly conserved

138Tmostly conserved

153Tmostly conserved

162Amostly conserved

168Tmostly conserved

174Tmostly conserved

177Avariable

183Amostly conserved

204Amostly conserved

213Cvariable

216Cmostly conserved

243Avariable

246Tmostly conserved

252Amostly conserved

258Tmostly conserved

264Tmostly conserved

279Cmostly conserved

282Amostly conserved

300Gmostly conserved

318Avariable

321Tmostly conserved

330Amostly conserved

333Cmostly conserved

339Cmostly conserved

354Cmostly conserved

372Cvariable

378Cmostly conserved

390Amostly conserved

396Gvariable

402Amostly conserved

405Cmostly conserved

441Cvariable

454Amostly conserved

477Tvariable

489Tvariable

492Avariable

522Avariable

561Gvariable

576Tmostly conserved

585Cmostly conserved

627Cmostly conserved

633Tmostly conserved

GGAAGATGAGCAGGAATTATAGGTCTATCAATAAGAATCTTAATTCGAATAGAACTCAGACAGCCAGGTACATTAATTGGAAATGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes9

BINs3

Most divergent pair3.4%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma naponensesame genus14.4%Amblyomma pecariumsame genus14.4%Amblyomma geoemydaesame genus14.9%Amblyomma longirostresame genus15.0%Amblyomma dissimilesame genus15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_050255 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6COX3ND3ND1ND5ND4ND4LND6CYTBND216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type273 records

Wild obs. + sensor156

Museum / vouchered117

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 26≤1 km 8≤10 km 1>10 km 6

41 georeferenced · 115 without coordinates

Open the mapobservation + sensor156

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 7≤10 km 2

9 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Harold Winfred Manter Laboratory of Parasitologylocation not on record	9
Mexico City, MX	7
Ciudad de México, MX	7
UFMG-CCTlocation not on record	5
Universidad de Caldas (UCaldas)location not on record	3
Ciudad de México, MX	3
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	2
New Haven, US	2
Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record	1
Frankfurt am Main	1
National Biodiversity Institute, Costa Ricalocation not on record	1

11 institutions · 41 of 117 vouchered records shown · 73 without an institution code

09Environmental DNA26 detections

Where the DNA of Amblyomma ovale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map6 countries0

Gymnopithys leucaspisNasua naricaRainforest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 21.1–26.4

Seasonal swing summer↔winter1.50 °C

Max temp (day)28.5 °C 23.8–30.0

Min temp (night)23.1 °C 18.0–24.0

Precipitation228 mm/mo 23.8–334

Air humidity67.6 % 62.3–72.7

Moisture balance81.0 mm/mo -117–213

Vapour deficit1,001 Pa 774–1,273

Wind speed2.00 m/s 1.30–3.40

Cloud cover29.7 % 13.3–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)