Amblyomma longirostre

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records140

Data sources6

Biological traits0

DNA specimens24

eDNA detections43

Sources6 archives

Databases and archives Amblyomma longirostre's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF140 records

Environmental DNA1 datasets · 6 countries43 detections

DNA & barcodingBOLD24 specimens

01Narrative

Amblyomma longirostre (лат.) — вид клещей рода Amblyomma из семейства Ixodidae. Южная Америка: Колумбия, Венесуэла, Французская Гвиана, Бразилия, Парагвай, Боливия, Аргентина (Мisiones) и Тринидад Остров, Панама. Основными хозяевами взрослых стадий развития служат древесные дикобразы рода Coendu. Клещи встречаются иногда и на других видах млекопитающих, включая человека. Незрелые клещи паразитируют на многих птицах, но в первую очередь на представителях воробьиных. Нимфы часто переносятся птицами на далекие расстояния, они были найдены в Мексике и в США, насколько раз в Пенсильвании. Вид был впервые описан в 1844 году немецким энтомологом и арахнологом Карлом Людвигом Кохом.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma longirostre has left across the world's sequence archives.

At a glance

DNA specimens24

BINs4

Marker genes2

eDNA detections43

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 79 variable positions, in barcode order

16Cmostly conserved

19Amostly conserved

20Amostly conserved

21Gmostly conserved

22Tmostly conserved

25Gmostly conserved

31Amostly conserved

37Amostly conserved

40Tmostly conserved

46Amostly conserved

52Tmostly conserved

64Cmostly conserved

76Cmostly conserved

85Gvariable

88Tmostly conserved

124Amostly conserved

130Tmostly conserved

133Tvariable

136Tmostly conserved

139Tmostly conserved

145Amostly conserved

151Tvariable

157Gmostly conserved

166Amostly conserved

187Avariable

190Tmostly conserved

194Tmostly conserved

199Tmostly conserved

205Tmostly conserved

209Cmostly conserved

214Gmostly conserved

217Amostly conserved

220Amostly conserved

223Tmostly conserved

226Amostly conserved

229Amostly conserved

235Amostly conserved

238Tvariable

259Gvariable

322Cmostly conserved

337Cvariable

340Avariable

391Cvariable

397Tmostly conserved

403Cvariable

412Gvariable

430Amostly conserved

442Tvariable

455Cmostly conserved

470Avariable

491Gmostly conserved

511Gmostly conserved

520Tvariable

530Tmostly conserved

544Cmostly conserved

547Cmostly conserved

550Amostly conserved

553Tmostly conserved

554Tmostly conserved

559Tmostly conserved

562Amostly conserved

565Tmostly conserved

571Tmostly conserved

575Cmostly conserved

578Cvariable

580Gvariable

604Amostly conserved

616Cmostly conserved

622Amostly conserved

624Gmostly conserved

625Amostly conserved

627Gmostly conserved

628Tmostly conserved

631Tmostly conserved

634Amostly conserved

643Tmostly conserved

647Cmostly conserved

648Amostly conserved

649Cmostly conserved

AATATATTTAATTTTCGGAAGTTGGGCAGGAATAATAGGTTTATCAATAAGTATTTTAATTCGCATAGAATTAGGCCAACCAGGGACTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes3

BINs4

Most divergent pair17.7%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma cohaerenssame genus13.5%Amblyomma tigrinumsame genus13.6%Amblyomma auriculariumsame genus14.1%Amblyomma latumsame genus14.2%Amblyomma naponensesame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type140 records

Wild obs. + sensor112

Museum / vouchered25

Other3

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 15≤1 km 6≤10 km 3>10 km 8

32 georeferenced · 80 without coordinates

Open the mapobservation + sensor112

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad de Caldas (UCaldas)location not on record	9
Harold Winfred Manter Laboratory of Parasitologylocation not on record	3
Mexico City, MX	2
Champaign, US	2
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Frankfurt am Main	1

7 institutions · 19 of 25 vouchered records shown · 4 without an institution code

09Environmental DNA43 detections

Where the DNA of Amblyomma longirostre was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map6 countries0

tropical lowland moist forest1. Forest & WoodlandGymnopithys leucaspis1. Forest & Woodland|1.5. Subtropical/Tropic…Phaenostictus mcleannaniMicrobates cinereiventris

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 13.7–26.4

Seasonal swing summer↔winter1.40 °C

Max temp (day)27.1 °C 17.2–29.1

Min temp (night)21.6 °C 11.7–24.2

Precipitation306 mm/mo 80.8–480

Air humidity71.4 % 59.0–77.7

Moisture balance160 mm/mo -46.5–345

Vapour deficit818 Pa 659–1,011

Wind speed1.60 m/s 0.9–4.00

Cloud cover38.7 % 13.6–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)