Alpheus clamator

Lockington, 1877 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records236

Data sources4

Biological traits2

DNA specimens3

eDNA detections7

Sources4 archives

Databases and archives Alpheus clamator's data was compiled from.

GBIFGlobal Biodiversity Information Facility133 records↗

OBISOcean Biodiversity Information System103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS236 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD3 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus clamator has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P662 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.40%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 4 variable positions, in barcode order

81Gvariable

330Gvariable

426Tvariable

510Avariable

ACCTTATACTTTATCTTTGGAGCCTGAGCTGGAATAGTAGGCACAGCTCTAAGTCTATTAATCCGAGCTGAGCTAGGCCAGCCCGGAAGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus collumianussame genus15.5%Alpheus deuteropussame genus16.9%Alpheus roseodigitalissame genus16.9%Alpheus edwardsiisame genus17.2%Alpheus gracilipessame genus17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type236 records

Wild obs. + sensor26

Museum / vouchered210

Range

Area of Occupancy AOO388 km²

Depth

0–200 m sunlit60

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15.1 m · max 82.3 m · 60 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 8≤1 km 1≤10 km 1>10 km 2

12 georeferenced · 14 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 66≤1 km 60≤10 km 24>10 km 9

159 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	55
CASlocation not on record	26
Santa Barbara Museum of Natural Historylocation not on record	14
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Washington, US	7
Cambridge, US	3
New Haven, US	1
	1

8 institutions · 114 of 210 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Alpheus clamator was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

pier pilings, ca. 175 m from shorepier pilings at low tiderocky intertidal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 15.9–16.8

Seasonal swing summer↔winter10.0 °C

Max temp (day)20.0 °C 19.5–21.7

Min temp (night)12.6 °C 11.6–14.2

Precipitation8.10 mm/mo 5.20–16.4

Air humidity60.7 % 59.1–65.9

Moisture balance-142 mm/mo -148–-127

Vapour deficit734 Pa 643–755

Wind speed2.80 m/s 2.60–4.00

Cloud cover26.4 % 25.4–28.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)