Alpheus roseodigitalis

Nomura & Anker, 2005 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records31

Data sources6

Biological traits4

DNA specimens7

eDNA detections0

Sources6 archives

Databases and archives Alpheus roseodigitalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

OBISOcean Biodiversity Information System10 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS31 records

DNA & barcodingBOLD7 specimens

01Narrative

Alpheus roseodigitalis is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2005 door Nomura & Anker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max10 m

Depth min1 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus roseodigitalis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BIN1

Most divergent pair2.2%

Where individuals differ — all 20 variable positions, in barcode order

76Tmostly conserved

190Tmostly conserved

211Amostly conserved

217Amostly conserved

220Tmostly conserved

223Cmostly conserved

226Avariable

250Amostly conserved

406Amostly conserved

409Gmostly conserved

454Gmostly conserved

487Amostly conserved

499Avariable

520Tmostly conserved

526Cmostly conserved

532Gmostly conserved

541Gmostly conserved

625Gmostly conserved

634Cmostly conserved

640Tmostly conserved

CATTTTTGGAGCCTGAGCAGGTATAGTTGGCACAGCCCTTAGTTTATTAATTCGAGCTGAGCTAGGCCAACCAGGTAGACTAATCGGCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus sororsame genus11.3%Alpheus angustilineatussame genus15.1%Alpheus estuariensissame genus15.9%Leptalpheus axianassaesame family16.6%Alpheus colombiensissame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor5

Museum / vouchered26

Range

Area of Occupancy AOO64 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 0 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2>10 km 2

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Paris, FR	5
University of Floridalocation not on record	3
Washington, US	3

4 institutions · 17 of 26 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)