Alpheus estuariensis

Christoffersen, 1984 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records779

Data sources6

Biological traits5

DNA specimens53

eDNA detections17

Sources6 archives

Databases and archives Alpheus estuariensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility390 records↗

OBISOcean Biodiversity Information System389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS779 records

Environmental DNA1 datasets · 3 countries17 detections

DNA & barcodingBOLD53 specimens

01Narrative

Alpheus estuariensis is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1984 door Christoffersen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length1.4 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max5 m

Depth min0 m

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus estuariensis has left across the world's sequence archives.

At a glance

DNA specimens53

BINs5

Marker genes3

eDNA detections17

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P508 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 56 variable positions, in barcode order

5Tmostly conserved

8Amostly conserved

11Tmostly conserved

15Tmostly conserved

17Amostly conserved

25Cmostly conserved

29Tmostly conserved

35Amostly conserved

41Amostly conserved

53Cmostly conserved

59Tmostly conserved

62Tmostly conserved

68Cmostly conserved

74Cmostly conserved

77Cmostly conserved

83Tmostly conserved

92Cmostly conserved

110Tmostly conserved

119Tmostly conserved

122Gmostly conserved

128Tmostly conserved

143Cmostly conserved

146Cmostly conserved

149Amostly conserved

153Tmostly conserved

155Amostly conserved

165Gmostly conserved

167Cmostly conserved

173Amostly conserved

181Gmostly conserved

209Cmostly conserved

224Cmostly conserved

230Amostly conserved

245Gmostly conserved

254Gmostly conserved

284Cmostly conserved

287Amostly conserved

311Gmostly conserved

320Tmostly conserved

329Cvariable

332Amostly conserved

341Tmostly conserved

356Amostly conserved

368Cmostly conserved

395Cmostly conserved

401Tmostly conserved

407Amostly conserved

441Cmostly conserved

452Gmostly conserved

455Cmostly conserved

473Tmostly conserved

476Cmostly conserved

488Gmostly conserved

494Cmostly conserved

500Amostly conserved

503Tmostly conserved

TAATTCGAGCTGAATTAGGCCAACCAGGTAGACTAATTGGAAACGACCAAATCTATAATGTTATTGTCACAGCCCACGCATTTGTAATAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes20

BINs5

Most divergent pair17.9%

S.AmericaAsiaN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus colombiensissame genus7.7%Alpheus obesomanussame genus13.8%Alpheus paracrinitussame genus14.0%Alpheus nuttingisame genus14.8%Alpheus angustilineatussame genus14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type779 records

Wild obs. + sensor712

Museum / vouchered67

Range

Area of Occupancy AOO812 km²

Depth

0–200 m sunlit370

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.3 m · max 53 m · 370 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 698

698 georeferenced · 14 without coordinates

Open the mapobservation + sensor712

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	13
Washington, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Museu Paraense Emílio Goeldilocation not on record	1
Mexico City, MX	1

5 institutions · 22 of 67 vouchered records shown · 18 without an institution code

09Environmental DNA17 detections

Where the DNA of Alpheus estuariensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.3–26.7

Seasonal swing summer↔winter3.30 °C

Max temp (day)30.0 °C 28.4–30.2

Min temp (night)23.0 °C 21.4–24.5

Precipitation177 mm/mo 96.9–317

Air humidity62.4 % 59.5–65.4

Moisture balance22.3 mm/mo

Vapour deficit1,262 Pa 1,142–1,390

Wind speed4.20 m/s

Cloud cover42.8 % 26.2–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)