Alpheus nuttingi

(Schmitt, 1924) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records134

Data sources7

Biological traits5

DNA specimens16

eDNA detections12

Sources7 archives

Databases and archives Alpheus nuttingi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

OBISOcean Biodiversity Information System20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS134 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD16 specimens

01Narrative

Alpheus nuttingi is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1924 door Schmitt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length3.68 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max5 m

Depth min0 m

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus nuttingi has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes3

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

1Amostly conserved

2Cmostly conserved

4Tmostly conserved

6Amostly conserved

9Cmostly conserved

10Tmostly conserved

11Tmostly conserved

12Cmostly conserved

13Amostly conserved

90Gmostly conserved

108Amostly conserved

109Amostly conserved

211Tmostly conserved

216Amostly conserved

237Tmostly conserved

243Amostly conserved

267Cvariable

270Cvariable

273Gmostly conserved

276Gvariable

291Cvariable

309Avariable

318Tmostly conserved

321Gvariable

342Tmostly conserved

369Tvariable

414Avariable

436Gmostly conserved

492Avariable

532Cmostly conserved

606Gmostly conserved

624Tmostly conserved

633Cmostly conserved

642Cmostly conserved

652Cmostly conserved

ACCTTATACTTCATTTTTGGCGCCTGGGCCGGTATAGTAGGGACTGCCCTCAGTCTCCTAATTCGAGCTGAATTAGGCCAACCAGGTAGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes5

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus colombiensissame genus14.5%Alpheus estuariensissame genus14.8%Alpheus platycheirussame genus14.8%Alpheus mathewsaesame genus15.3%Alpheus cristulifronssame genus16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type134 records

Wild obs. + sensor19

Museum / vouchered113

Other2

Origin

Native2

Range

Area of Occupancy AOO292 km²

Depth

0–200 m sunlit12

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.9 m · max 9 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2>10 km 3

5 georeferenced · 14 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 5≤1 km 1≤10 km 8>10 km 3

17 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	19
Instituto Oceanográfico del Pacífico, Secretaría de Marinalocation not on record	14
Washington, US	14
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	7
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	6
UM-RSMASlocation not on record	5
	5
IEPAlocation not on record	4
Cambridge, US	3
FCMMlocation not on record	3
New Haven, US	2
Texas Cooperative Wildlife Collectionlocation not on record	2
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	1
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	1
Museu de Zoologia da Universidade de Sao Paulolocation not on record	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
San Nicolás de los Garza, MX	1
Universidad de Antioquia (UdeA)location not on record	1
University of Louisiana at Lafayettelocation not on record	1

19 institutions · 91 of 113 vouchered records shown · 10 without an institution code

09Environmental DNA12 detections

Where the DNA of Alpheus nuttingi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.5–25.7

Seasonal swing summer↔winter1.70 °C

Max temp (day)27.6 °C 27.6–28.4

Min temp (night)23.9 °C 23.1–23.9

Precipitation276 mm/mo 242–276

Air humidity63.7 % 63.7–63.8

Moisture balance117 mm/mo 91.9–117

Vapour deficit1,193 Pa 1,181–1,193

Wind speed3.10 m/s 2.50–3.10

Cloud cover31.0 % 31.0–35.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)