Alpheus collumianus

Stimpson, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records321

Data sources7

Biological traits4

DNA specimens8

eDNA detections27

Sources7 archives

Databases and archives Alpheus collumianus's data was compiled from.

GBIFGlobal Biodiversity Information Facility173 records↗

OBISOcean Biodiversity Information System148 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS321 records

Environmental DNA1 datasets · 3 countries27 detections

DNA & barcodingBOLD8 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max75 m

Depth min0 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus collumianus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections27

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)5.0%

Haplotypes2

BIN1

Most divergent pair17.3%

Where individuals differ — all 114 variable positions, in barcode order

1Cmostly conserved

4Cmostly conserved

5Tmostly conserved

19Tmostly conserved

22Amostly conserved

25Tmostly conserved

28Amostly conserved

31Tmostly conserved

34Tmostly conserved

40Gmostly conserved

49Tmostly conserved

52Tmostly conserved

56Cmostly conserved

59Cmostly conserved

64Cmostly conserved

70Amostly conserved

76Cmostly conserved

79Amostly conserved

88Gmostly conserved

94Amostly conserved

103Tmostly conserved

112Tmostly conserved

130Cmostly conserved

133Gmostly conserved

139Gmostly conserved

142Tmostly conserved

157Tmostly conserved

163Tmostly conserved

172Tmostly conserved

187Tmostly conserved

190Tmostly conserved

196Amostly conserved

197Tmostly conserved

211Amostly conserved

214Tmostly conserved

220Cmostly conserved

232Tmostly conserved

244Amostly conserved

256Cmostly conserved

262Gmostly conserved

265Amostly conserved

283Tmostly conserved

286Cmostly conserved

289Tmostly conserved

290Cmostly conserved

298Amostly conserved

302Tmostly conserved

307Tmostly conserved

313Amostly conserved

316Gmostly conserved

319Cmostly conserved

325Cmostly conserved

334Gmostly conserved

337Cmostly conserved

343Cmostly conserved

346Amostly conserved

349Gmostly conserved

355Amostly conserved

358Cmostly conserved

367Tmostly conserved

370Gmostly conserved

373Tmostly conserved

385Cmostly conserved

388Amostly conserved

391Amostly conserved

394Tmostly conserved

403Amostly conserved

409Gmostly conserved

415Tmostly conserved

418Amostly conserved

424Cmostly conserved

427Cmostly conserved

428Cmostly conserved

445Tmostly conserved

454Amostly conserved

457Tmostly conserved

463Cmostly conserved

475Amostly conserved

481Tmostly conserved

484Tmostly conserved

487Gmostly conserved

493Tmostly conserved

499Tmostly conserved

508Cmostly conserved

514Tmostly conserved

517Amostly conserved

520Tmostly conserved

521Tmostly conserved

529Cmostly conserved

532Tmostly conserved

535Amostly conserved

536Tmostly conserved

538Amostly conserved

541Cmostly conserved

550Tmostly conserved

553Tmostly conserved

556Tmostly conserved

557Cmostly conserved

565Amostly conserved

571Cmostly conserved

574Amostly conserved

581Tmostly conserved

589Tmostly conserved

595Cmostly conserved

598Amostly conserved

601Cmostly conserved

604Cmostly conserved

616Tmostly conserved

625Gmostly conserved

631Amostly conserved

637Tmostly conserved

643Tmostly conserved

652Tmostly conserved

653Cmostly conserved

CACCTTATACTTTATTTTTGGAGCTTGAGCTGGTATAGTGGGCACAGCTCTTAGTCTACTAATCCGAGCAGAACTCGGACAACCAGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus peaseisame genus2.7%Alpheus clamatorsame genus15.5%Alpheus sereneisame genus17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type321 records

Wild obs. + sensor22

Museum / vouchered298

Other1

Range

Area of Occupancy AOO640 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3.4 m · max 12 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤1 km 2>10 km 8

10 georeferenced · 12 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 1≤1 km 34≤10 km 18>10 km 1

54 georeferenced · 244 without coordinates

Open the institutions mapphysical evidence298

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	41
Sydney, AU	26
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	19
Washington, US	17
Honolulu, US	17
Museum and Art Gallery of the Northern Territorylocation not on record	7
	5
Frankfurt am Main	5
Natick, US	4
University of Floridalocation not on record	4
Stockholm, SE	4
New Haven, US	2
Cambridge, US	2
Brussels, BE	2
CASlocation not on record	1
Chiba, JP	1
Western Australian Museumlocation not on record	1
Auckland, NZ	1

18 institutions · 159 of 298 vouchered records shown · 3 without an institution code

09Environmental DNA27 detections

Where the DNA of Alpheus collumianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map3 countries0

Coral Reefouter reef slopevolcanic rocky shore and fringing flatpatch reef top

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 20.1–25.4

Seasonal swing summer↔winter3.60 °C

Max temp (day)25.0 °C 22.7–29.7

Min temp (night)22.4 °C 17.1–23.7

Precipitation50.7 mm/mo 10.9–90.5

Air humidity59.7 % 54.8–71.8

Vapour deficit1,166 Pa 663–1,593

Cloud cover33.5 % 13.1–33.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)