Alpheus deuteropus

Hilgendorf, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records649

Data sources9

Biological traits2

DNA specimens9

eDNA detections7

Sources9 archives

Databases and archives Alpheus deuteropus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

OBISOcean Biodiversity Information System521 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS649 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD9 specimens

01Narrative

Alpheus deuteropus or the petroglyph shrimp is a snapper or pistol shrimp in the family Alpheidae. It lives on coral reefs in tropical parts of the Indian and Pacific Oceans and in the Red Sea, as a commensal of corals such as Porites lobata. Its presence among the lobes leaves tunnels, cracks and grooves in the surface.Marine Life Pro

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus deuteropus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

1Cmostly conserved

43Tmostly conserved

79Cmostly conserved

109Gmostly conserved

112Tmostly conserved

122Gmostly conserved

127Cmostly conserved

130Tmostly conserved

154Tmostly conserved

178Tmostly conserved

244Gmostly conserved

253Gmostly conserved

256Tmostly conserved

265Amostly conserved

271Cmostly conserved

319Amostly conserved

337Cmostly conserved

343Gmostly conserved

388Gmostly conserved

391Cvariable

400Tmostly conserved

409Cvariable

418Avariable

454Amostly conserved

457Gmostly conserved

481Tmostly conserved

487Amostly conserved

499Amostly conserved

547Amostly conserved

571Cvariable

625Amostly conserved

652Cmostly conserved

CACCTTATACTTTATTTTTGGAGCCTGAGCTGGAATAGTAGGTACAGCGCTCAGGCTACTAATCCGGGCGGAACTAGGCCAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes4

BINs2

Most divergent pair4.6%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus euphrosynesame genus16.4%Alpheus clamatorsame genus16.9%Alpheus pareuchirussame genus17.5%Alpheus digitalissame genus17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type649 records

Wild obs. + sensor538

Museum / vouchered110

Other1

Range

Area of Occupancy AOO596 km²

Depth

0–200 m sunlit471

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 11.9 m · max 17.5 m · 471 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 32≤1 km 18≤10 km 2>10 km 4

56 georeferenced · 482 without coordinates

Open the mapobservation + sensor538

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	38
Washington, US	13
	3
Museum für Naturkunde Berlin (Zoological Collections)location not on record	3
Honolulu, US	1
Sydney, AU	1
Museums Victorialocation not on record	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
CASlocation not on record	1
Paris, FR	1

10 institutions · 63 of 110 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Alpheus deuteropus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

outer reef slopeouter reef slope outside major reef passage

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–23.6

Seasonal swing summer↔winter3.30 °C

Max temp (day)25.0 °C

Min temp (night)22.4 °C

Precipitation50.7 mm/mo

Air humidity59.7 %

Vapour deficit1,166 Pa

Cloud cover33.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)