Alpheus gracilipes

Stimpson, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records269

Data sources7

Biological traits4

DNA specimens24

eDNA detections24

Sources7 archives

Databases and archives Alpheus gracilipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility150 records↗

OBISOcean Biodiversity Information System119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS269 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD24 specimens

01Narrative

Alpheus gracilipes is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1860 door Stimpson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max22 m

Depth min0 m

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus gracilipes has left across the world's sequence archives.

At a glance

DNA specimens24

BINs4

Marker genes2

eDNA detections24

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)4.4%

Haplotypes2

BINs4

Most divergent pair15.4%

Where individuals differ — all 107 variable positions, in barcode order

3Tmostly conserved

6Cmostly conserved

9Tmostly conserved

12Amostly conserved

18Amostly conserved

21Cmostly conserved

24Cmostly conserved

30Cmostly conserved

33Cmostly conserved

39Cmostly conserved

42Cmostly conserved

46Tmostly conserved

49Tmostly conserved

57Gmostly conserved

60Cmostly conserved

63Amostly conserved

66Gmostly conserved

75Amostly conserved

78Tmostly conserved

82Tmostly conserved

87Tmostly conserved

90Tmostly conserved

102Cmostly conserved

105Cmostly conserved

108Tmostly conserved

111Amostly conserved

117Tmostly conserved

123Amostly conserved

126Cmostly conserved

129Amostly conserved

156Amostly conserved

168Tmostly conserved

177Cmostly conserved

180Amostly conserved

192Tmostly conserved

202Cmostly conserved

204Gmostly conserved

213Amostly conserved

252Gmostly conserved

255Cmostly conserved

261Cmostly conserved

264Cmostly conserved

267Gmostly conserved

276Amostly conserved

279Cmostly conserved

280Tmostly conserved

282Amostly conserved

297Tmostly conserved

300Amostly conserved

303Amostly conserved

306Amostly conserved

327Amostly conserved

333Amostly conserved

336Amostly conserved

339Cmostly conserved

345Amostly conserved

348Tmostly conserved

354Tmostly conserved

366Tmostly conserved

369Tmostly conserved

387Tmostly conserved

390Tmostly conserved

399Amostly conserved

414Gmostly conserved

423Amostly conserved

441Tmostly conserved

444Tmostly conserved

453Cmostly conserved

465Gmostly conserved

489Tmostly conserved

498Cmostly conserved

504Cmostly conserved

507Amostly conserved

510Cmostly conserved

522Cmostly conserved

525Tmostly conserved

528Tmostly conserved

531Tmostly conserved

540Cmostly conserved

546Cmostly conserved

552Cmostly conserved

555Amostly conserved

558Tmostly conserved

561Cmostly conserved

563Cmostly conserved

564Tmostly conserved

567Amostly conserved

568Cmostly conserved

571Tmostly conserved

573Amostly conserved

576Cmostly conserved

579Cmostly conserved

582Amostly conserved

583Amostly conserved

585Tmostly conserved

586Cmostly conserved

588Tmostly conserved

589Amostly conserved

597Cmostly conserved

603Tmostly conserved

612Cmostly conserved

621Tmostly conserved

627Tmostly conserved

630Tmostly conserved

631Tmostly conserved

633Amostly conserved

643Cmostly conserved

TTTATCTTTGGAGCCTGAGCCGGCATAGTCGGCACAGCCCTCAGTTTATTAATCCGGGCCGAACTGGGCCAACCAGGTAGATTAATTGGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus angustilineatussame genus14.4%Alpheus parvimaculatussame genus14.7%Alpheus sororsame genus15.0%Alpheus euphrosynesame genus15.6%Alpheus strenuussame genus15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type269 records

Wild obs. + sensor6

Museum / vouchered260

Other3

Range

Area of Occupancy AOO384 km²

Depth

0–200 m sunlit12

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.2 m · max 68.5 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 2≤1 km 2≤10 km 14>10 km 1

19 georeferenced · 241 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	34
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	22
Honolulu, US	14
Sydney, AU	14
Museum and Art Gallery of the Northern Territorylocation not on record	13
University of Floridalocation not on record	11
Stockholm, SE	10
Paris, FR	9
	4
Natick, US	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
Western Australian Museumlocation not on record	2
Frankfurt am Main	2
Cambridge, US	1
South Kensington, GB	1

15 institutions · 141 of 260 vouchered records shown · 1 without an institution code

09Environmental DNA24 detections

Where the DNA of Alpheus gracilipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

patch reefsand flat and fringing reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 20.1–23.7

Seasonal swing summer↔winter3.30 °C

Max temp (day)25.0 °C 21.9–25.1

Min temp (night)22.4 °C 18.1–22.5

Precipitation82.8 mm/mo 50.7–171

Air humidity60.0 % 59.7–71.8

Vapour deficit1,166 Pa 663–1,172

Cloud cover33.5 % 25.1–33.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)