Agelas sceptrum

(Lamarck, 1815) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Agelasida/Agelasidae/Agelas

At a glance

Occurrence records751

Data sources9

Biological traits2

DNA specimens8

eDNA detections1

Sources9 archives

Databases and archives Agelas sceptrum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility404 records↗

OBISOcean Biodiversity Information System347 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF · OBIS751 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD8 specimens

01Narrative

Agelas sceptrum is een sponssoort in de taxonomische indeling van de gewone sponzen (Demospongiae). Het lichaam van de spons bestaat uit kiezelnaalden en sponginevezels, en is in staat om veel water op te nemen. De spons behoort tot het geslacht Agelas en behoort tot de familie Agelasidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1815 door Lamarck.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition8 compounds

Compounds documented for Agelas sceptrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pyrrole alkaloids3

Cholestane steroids $ Ergostane steroids2

Stigmastane steroids1

Cholestane steroids1

Acyl phloroglucinols $ Anthraquinones and anthrones1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(3beta,4alpha,5alpha)-4-Methylcholest-8-en-3-ol	present	LOTUS
(3S,9S,10R,13R,14R,17R)-17-[(E,2R,5R)-5,7-dimethyloct-3-en-2-yl]-10,13-dimethyl-2,3,4,9,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
beta-Sitosterol	present	LOTUS
Campesterol	present	LOTUS
Knipholone	present	NPASS
N-[3-(2-amino-1H-imidazol-5-yl)prop-2-enyl]-4,5-dibromo-1H-pyrrole-2-carboxamide	present	LOTUS
Oroidin	present	LOTUS
Sceptrin	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelas sceptrum has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

174Gmostly conserved

195Tmostly conserved

225Tmostly conserved

249Tvariable

261Gmostly conserved

291Tmostly conserved

309Tvariable

354Tmostly conserved

402Tmostly conserved

TTATTATTAGGAGCCTTTAGCGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGGTTAGAATTATCGGCTCCGGGCTCAATGCTAGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes6

BIN1

Most divergent pair1.1%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelas disparsame genus1.9%Agelas cervicornissame genus2.0%Agelas sventressame genus6.4%Agelas clathrodessame genus6.8%Agelas mauritianasame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type751 records

Wild obs. + sensor746

Museum / vouchered5

Range

Area of Occupancy AOO264 km²

Depth

0–200 m sunlit346

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 64 m · max 114 m · 346 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 612≤1 km 41≤10 km 8>10 km 10

671 georeferenced · 75 without coordinates

Open the mapobservation + sensor746

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	5

1 institutions · 5 of 5 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Agelas sceptrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)