Agelas clathrodes

(Schmidt, 1870) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Agelasida/Agelasidae/Agelas

At a glance

Occurrence records1 263

Data sources12

Biological traits6

DNA specimens40

eDNA detections13

Sources12 archives

Databases and archives Agelas clathrodes's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 095 records↗

OBISOcean Biodiversity Information System168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS28 compounds

Occurrence & distributionGBIF · OBIS1 263 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD40 specimens

Genome at a glanceGoaT · NCBI≈316 Mbp

01Narrative

Agelas clathrodes, also known as the orange elephant ear sponge, is a species of sea sponge. It lives on reefs in the Caribbean, usually more than 10 m below the surface of the ocean. It takes various forms, and its color is reddish orange.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits3

Depth max61 m

Depth min2 m

Vulnerability10

03Chemical composition28 compounds

Compounds documented for Agelas clathrodes across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Neutral glycosphingolipids5

Pyrrole alkaloids5

Fatty acyl glycosides of mono- and disaccharides $ Neutral glycosphingolipids4

Dipeptides4

Imidazole alkaloids4

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-[(4-bromo-1H-pyrrole-2-carbonyl)amino]-3-[(4S)-3,4-dimethyl-1,5-dihydroimidazol-3-ium-4-yl]propanoate	present	LOTUS
(2R)-2-[(4-bromo-1H-pyrrole-2-carbonyl)amino]-3-[(5S)-1,5-dimethyl-4H-imidazol-5-yl]propanoic acid	present	LOTUS
(2R,3R,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,4S)-4-hydroxy-2-tetradecyloctadec-2-enoxy]oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5R,6R)-2-(hydroxymethyl)-6-[(Z,4R)-4-hydroxy-2-tetradecyloctadec-2-enoxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,4S)-4-hydroxy-17-methyl-2-tetradecyloctadec-2-enoxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,4S)-4-hydroxy-2-tetradecyloctadec-2-enoxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,4S,16R)-4-hydroxy-16-methyl-2-tetradecyloctadec-2-enoxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,4S,16S)-4-hydroxy-16-methyl-2-tetradecyloctadec-2-enoxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(Z,4R)-4-hydroxy-17-methyl-2-tetradecyloctadec-2-enoxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(Z,4R)-4-hydroxy-2-tetradecyloctadec-2-enoxy]oxane-3,4,5-triol	present	LOTUS

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelas clathrodes has left across the world's sequence archives.

At a glance

DNA specimens40

BINs7

Marker genes3

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P615 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

6Amostly conserved

12Amostly conserved

15Cmostly conserved

33Amostly conserved

39Amostly conserved

40Tmostly conserved

45Gmostly conserved

54Gmostly conserved

57Cvariable

61Cmostly conserved

66Tmostly conserved

72Tmostly conserved

75Gmostly conserved

87Gmostly conserved

96Tmostly conserved

117Tmostly conserved

123Cvariable

131Tmostly conserved

150Gmostly conserved

186Cmostly conserved

219Tmostly conserved

231Avariable

240Cmostly conserved

258Tmostly conserved

261Tmostly conserved

264Cmostly conserved

267Tmostly conserved

276Gmostly conserved

282Gmostly conserved

285Cmostly conserved

288Avariable

291Amostly conserved

294Gmostly conserved

309Gmostly conserved

321Cmostly conserved

339Gmostly conserved

345Cmostly conserved

366Tmostly conserved

372Cmostly conserved

378Gmostly conserved

381Gmostly conserved

384Amostly conserved

396Amostly conserved

402Gmostly conserved

438Amostly conserved

441Amostly conserved

465Cmostly conserved

480Tmostly conserved

507Amostly conserved

514Tmostly conserved

516Gmostly conserved

555Tmostly conserved

561Cmostly conserved

570Amostly conserved

591Amostly conserved

600Cmostly conserved

603Avariable

ATGATAGGAACAGCCTTTAGTGTGCTTATTAGATTAGAATTATCGGCTCCGGGGTCCATGCTAGGTGATGATCAGCTTTATAATGTGATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes11

BINs7

Most divergent pair8.9%

OtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelas citrinasame genus4.7%Agelas mauritianasame genus6.6%Agelas sceptrumsame genus6.8%Agelas cerebrumsame genus6.8%Agelas coniferasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agelas clathrodes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈315 549 340 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agelas clathrodes0.32 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness77.7% BUSCO

08Occurrence & distribution

Record type1 263 records

Wild obs. + sensor1 150

Museum / vouchered113

Range

Area of Occupancy AOO1 064 km²

Depth

0–200 m sunlit159

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 52 m · max 280 m · 160 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 369≤1 km 106≤10 km 33>10 km 9

517 georeferenced · 633 without coordinates

Open the mapobservation + sensor1 150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 12

12 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Facultad de Ciencias Biológicas y Agropecuarias, Universidad Veracruzana, Región Poza Rica-Tuxpanlocation not on record	40
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	10
Washington, US	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Earth Sciences New Zealandlocation not on record	1
Auckland, NZ	1
WoRMS Editorial Boardlocation not on record	1

7 institutions · 63 of 113 vouchered records shown · 34 without an institution code

09Environmental DNA13 detections

Where the DNA of Agelas clathrodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–26.2

Seasonal swing summer↔winter3.10 °C

Max temp (day)25.7 °C 25.7–26.9

Min temp (night)24.4 °C 24.4–25.4

Precipitation57.6 mm/mo 57.6–96.2

Air humidity59.7 % 59.7–61.9

Vapour deficit1,274 Pa 1,274–1,286

Cloud cover22.9 % 20.8–22.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agelas clathrodes

At a glance

Sources12 archives

Size & morphology1

Habitat & environment2

Other traits3

Compound class profile5 classes

Documented compounds28 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 263 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 263 records