Agelas citrina

Gotera & Alcolado, 1987 · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Agelasida/Agelasidae/Agelas

At a glance

Occurrence records434

Data sources7

Biological traits2

DNA specimens41

eDNA detections20

Sources7 archives

Databases and archives Agelas citrina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility228 records↗

OBISOcean Biodiversity Information System206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS434 records

Environmental DNA2 datasets · 3 countries20 detections

DNA & barcodingBOLD41 specimens

01Narrative

Agelas citrina is een sponssoort in de taxonomische indeling van de gewone sponzen (Demospongiae). Het lichaam van de spons bestaat uit kiezelnaalden en sponginevezels, en is in staat om veel water op te nemen. De spons behoort tot het geslacht Agelas en behoort tot de familie Agelasidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1987 door Gotera & Alcolado.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelas citrina has left across the world's sequence archives.

At a glance

DNA specimens41

BINs4

Marker genes4

eDNA detections20

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P644 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.2%

Haplotypes2

BINs4

Most divergent pair3.7%

Where individuals differ — all 41 variable positions, in barcode order

12Gvariable

30Tvariable

36Amostly conserved

63Gvariable

78Avariable

81Amostly conserved

85Cmostly conserved

96Cvariable

99Amostly conserved

120Avariable

147Cmostly conserved

168Tmostly conserved

174Amostly conserved

183Cmostly conserved

216Tmostly conserved

243Cmostly conserved

264Tmostly conserved

282Tmostly conserved

285Tmostly conserved

291Cmostly conserved

300Amostly conserved

315Cvariable

333Cmostly conserved

354Tmostly conserved

363Tmostly conserved

420Gmostly conserved

426Amostly conserved

489Tmostly conserved

501Amostly conserved

504Amostly conserved

516Gmostly conserved

526Tmostly conserved

531Gmostly conserved

538Cmostly conserved

540Cvariable

563Cmostly conserved

579Cmostly conserved

615Gmostly conserved

621Gmostly conserved

624Cvariable

627Tmostly conserved

TTATTATTAGGGGCCTTTAGCGGAATGATTGGAACAGCCTTTAGTGTGCTTATTAGATTAGAGTTATCGGCTCCGGGATCAATGCTAGGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelas sventressame genus4.5%Agelas clathrodessame genus4.7%Agelas mauritianasame genus6.0%Agelas sceptrumsame genus7.4%Agelas cerebrumsame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type434 records

Wild obs. + sensor377

Museum / vouchered57

Range

Area of Occupancy AOO296 km²

Depth

0–200 m sunlit199

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 56.2 m · max 280 m · 200 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 225≤1 km 5≤10 km 8>10 km 8

246 georeferenced · 131 without coordinates

Open the mapobservation + sensor377

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 57 records without

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Washington, US	3
WoRMS Editorial Boardlocation not on record	2
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	1

4 institutions · 12 of 57 vouchered records shown · 35 without an institution code

09Environmental DNA20 detections

Where the DNA of Agelas citrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

Atlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.1–26.8

Seasonal swing summer↔winter2.10 °C

Max temp (day)26.0 °C 25.7–27.5

Min temp (night)25.2 °C 24.4–25.9

Precipitation24.9 mm/mo 13.6–130

Air humidity63.5 % 59.7–65.0

Moisture balance-91.1 mm/mo

Vapour deficit1,209 Pa 1,195–1,274

Wind speed4.40 m/s

Cloud cover17.0 % 12.9–22.9

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)