Agelas sventres

Lehnert & van Soest, 1996 · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Agelasida/Agelasidae/Agelas

At a glance

Occurrence records184

Data sources9

Biological traits2

DNA specimens47

eDNA detections24

Sources9 archives

Databases and archives Agelas sventres's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

OBISOcean Biodiversity Information System40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF · OBIS184 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD47 specimens

01Narrative

Agelas sventres is een sponssoort in de taxonomische indeling van de gewone sponzen (Demospongiae). Het lichaam van de spons bestaat uit kiezelnaalden en sponginevezels, en is in staat om veel water op te nemen. De spons behoort tot het geslacht Agelas en behoort tot de familie Agelasidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1996 door Lehnert & van Soest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition9 compounds

Compounds documented for Agelas sventres across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Pyrrole alkaloids6

Methyl xanthones $ Naphthoquinones2

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
4,5-Dibromo-2-Pyrrolic Acid	present	LOTUS
6-Deoxybikaverin	present	NPASS
Hymenidin	present	LOTUS
N-[3-(2-amino-1H-imidazol-5-yl)prop-2-enyl]-4,5-dibromo-1-methylpyrrole-2-carboxamide	present	LOTUS
N-[3-(2-amino-1H-imidazol-5-yl)prop-2-enyl]-4,5-dibromo-1H-pyrrole-2-carboxamide	present	LOTUS
N-[3-(2-amino-1H-imidazol-5-yl)prop-2-enyl]-4-bromo-1H-pyrrole-2-carboxamide	present	LOTUS
Oroidin	present	LOTUS
Sventrin	present	LOTUS

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelas sventres has left across the world's sequence archives.

At a glance

DNA specimens47

BINs7

Marker genes3

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P644 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

12Gmostly conserved

57Amostly conserved

69Gvariable

78Gmostly conserved

81Cmostly conserved

105Tmostly conserved

111Gmostly conserved

120Tmostly conserved

141Tmostly conserved

147Cmostly conserved

162Tmostly conserved

168Cmostly conserved

192Amostly conserved

195Cmostly conserved

216Cmostly conserved

228Tmostly conserved

243Tmostly conserved

264Cmostly conserved

273Tvariable

282Cmostly conserved

285Tvariable

315Avariable

333Gmostly conserved

345Tmostly conserved

351Amostly conserved

360Gmostly conserved

366Gmostly conserved

369Cmostly conserved

381Gmostly conserved

402Cvariable

405Gmostly conserved

408Amostly conserved

426Gmostly conserved

447Tmostly conserved

462Avariable

465Amostly conserved

469Avariable

490Tmostly conserved

504Tvariable

519Tmostly conserved

520Tvariable

561Tmostly conserved

582Avariable

585Cvariable

594Tmostly conserved

609Cmostly conserved

612Amostly conserved

627Gmostly conserved

TTATTATTAGGGGCCTTTAGCGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGATTAGAATTATCGGCTCCGGGGTCCATGCTAGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes3

BINs7

Most divergent pair1.9%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelas citrinasame genus4.5%Agelas mauritianasame genus6.4%Agelas sceptrumsame genus6.4%Agelas cerebrumsame genus6.4%Agelas coniferasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type184 records

Wild obs. + sensor129

Museum / vouchered55

Range

Area of Occupancy AOO216 km²

Depth

0–200 m sunlit38

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 18 m · max 102 m · 38 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 48≤1 km 9≤10 km 5>10 km 6

68 georeferenced · 61 without coordinates

Open the mapobservation + sensor129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 55 records without

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
WoRMS Editorial Boardlocation not on record	2
Washington, US	2
Masindi, UG	1

5 institutions · 9 of 55 vouchered records shown · 41 without an institution code

09Environmental DNA24 detections

Where the DNA of Agelas sventres was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.8 °C 25.7–27.3

Seasonal swing summer↔winter2.10 °C

Max temp (day)27.5 °C 26.0–27.9

Min temp (night)25.9 °C 25.2–26.6

Precipitation130 mm/mo 13.6–182

Air humidity64.6 % 63.5–65.0

Moisture balance-17.0 mm/mo

Vapour deficit1,223 Pa 1,195–1,284

Wind speed4.40 m/s

Cloud cover20.5 % 12.9–25.0

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)