Agelas conifera

(Schmidt, 1870) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Agelasida/Agelasidae/Agelas

At a glance

Occurrence records1 113

Data sources12

Biological traits7

DNA specimens46

eDNA detections4

Sources12 archives

Databases and archives Agelas conifera's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility941 records↗

OBISOcean Biodiversity Information System172 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Chemical compositionLOTUS · NPASS51 compounds

Occurrence & distributionGBIF · OBIS1 113 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD46 specimens

Genome at a glanceGoaT · NCBI254 Mbp

01Narrative

Agelas conifera, also known as the brown tube sponge, is a species of sponge. Its color is brown, tan, or greyish brown with a lighter interior. It is common in the Caribbean and Bahamas, and occasional in Florida.Humann, Paul, Reef creature Identification, Edited by Ned Deloach. New World Publications, Inc., 1992, p. 22-23. Agelas conifera contains bromopyrrole alkaloids, notably sceptrin and oroidin, and levels of these feeding-deterrents increase upon predation.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length50 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max12 m

Depth min9 m

Vulnerability40

03Chemical composition51 compounds

Compounds documented for Agelas conifera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pyrrole alkaloids11

Branched fatty acids10

Unsaturated fatty acids9

Flavonols6

Branched fatty acids $ Unsaturated fatty acids5

Documented compounds51 total

Tissue Source Quantified only

Compound	Amount	Source
10-Methylhexadecanoic acid	present	LOTUS
11-Nonadecenoic acid	present	LOTUS
12-Methyloctadecanoic acid	present	LOTUS
12-Methyltridecanoic acid	present	LOTUS
13-Methyltetradecanoic Acid	present	LOTUS
14-Methylhexadec-9-Enoic Acid	present	LOTUS
14-Methylpentadecanoic acid	present	LOTUS
15-Methylheptadecanoic acid	present	LOTUS
15-Methylhexadecanoic acid	present	LOTUS
2-Methyleicosanoic acid	present	LOTUS

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelas conifera has left across the world's sequence archives.

At a glance

DNA specimens46

BINs1

Marker genes3

eDNA detections4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

154Gvariable

241Gvariable

271Tvariable

289Gvariable

295Tmostly conserved

382Tvariable

CGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGGTTAGAATTATCGGCTCCGGGCTCAATGCTAGGTGATGATCAGCTTTACAATGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes4

BIN1

Most divergent pair0.97%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelas disparsame genus2.1%Agelas cervicornissame genus2.3%Agelas sventressame genus6.5%Agelas clathrodessame genus6.8%Agelas mauritianasame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agelas conifera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size254 280 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agelas conifera0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness74.3% BUSCO

08Occurrence & distribution

Record type1 113 records

Wild obs. + sensor1 019

Museum / vouchered94

Range

Area of Occupancy AOO816 km²

Depth

0–200 m sunlit155

200–1000 m twilight3

1–4 km midnight0

>4 km abyssal0

median 18 m · max 270 m · 158 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 279≤1 km 72≤10 km 13>10 km 11

375 georeferenced · 644 without coordinates

Open the mapobservation + sensor1 019

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 9≤1 km 2>10 km 1

12 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
Moscow State Universitylocation not on record	7
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	4
WoRMS Editorial Boardlocation not on record	3
Washington, US	3
UM-RSMASlocation not on record	2
CASlocation not on record	1
Auckland, NZ	1

8 institutions · 32 of 94 vouchered records shown · 35 without an institution code

09Environmental DNA4 detections

Where the DNA of Agelas conifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agelas conifera

At a glance

Sources12 archives

Size & morphology1

Habitat & environment3

Other traits3

Compound class profile5 classes

Documented compounds51 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 113 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 113 records