Agelas cervicornis

(Schmidt, 1870) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Agelasida/Agelasidae/Agelas

At a glance

Occurrence records75

Data sources8

Biological traits2

DNA specimens4

eDNA detections0

Sources8 archives

Databases and archives Agelas cervicornis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

OBISOcean Biodiversity Information System35 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS92 compounds

Occurrence & distributionGBIF · OBIS75 records

DNA & barcodingBOLD4 specimens

01Narrative

Agelas cervicornis is een sponssoort in de taxonomische indeling van de gewone sponzen (Demospongiae). Het lichaam van de spons bestaat uit kiezelnaalden en sponginevezels, en is in staat om veel water op te nemen. De spons behoort tot het geslacht Agelas en behoort tot de familie Agelasidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1870 door Schmidt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition92 compounds

Compounds documented for Agelas cervicornis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cassane diterpenoids31

Aurones7

Imidazole alkaloids5

Neutral glycosphingolipids2

Isoflavanones2

Documented compounds92 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,1aR,1bR,3aR,7aR,7bS,9aR)-3a-hydroxy-1-(hydroxymethyl)-4,4,7a,9a-tetramethyl-1,1a,1b,2,3,5,6,7,7b,8-decahydrocyclopropa[a]phenanthren-9-one	present	NPASS
(1S,4R,6R,10R)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane	present	NPASS
(2R)-N-[(2S,3S,4R)-1-[(2S,3R,4S,5S,6R)-4-[(2R,3R,4S,5S)-5-[(1R)-1,2-dihydroxyethyl]-3,4-dihydroxyoxolan-2-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydroxyhexadecan-2-yl]-2-hydroxytetracosanamide	present	LOTUS
(2R)-N-[(2S,3S,4R)-1-[(2S,3R,4S,5S,6R)-4-[(2S,3R,4R,5S)-5-[(1R)-1,2-dihydroxyethyl]-3,4-dihydroxyoxolan-2-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydroxyhexadecan-2-yl]-2-hydroxytetracosanamide	present	LOTUS
(2S)-5,7-dimethoxy-2-phenyl-3,4-dihydro-2H-1-benzopyran-4-one	present	NPASS
(2S)-5,7-Dimethoxy-3',4'-methylenedioxyflavanone	present	NPASS
(3E)-3-((3,4-dimethoxyphenyl)methylidene)-7-methoxychromen-4-one	present	NPASS
(3E)-3-(1,3-benzodioxol-5-ylmethylidene)-7-hydroxychromen-4-one	present	NPASS
(3E)-3-(1,3-benzodioxol-5-ylmethylidene)-7-methoxychromen-4-one	present	NPASS
(3E)-3-[(3-hydroxy-4-methoxyphenyl)methylidene]-6,7-dimethoxychromen-4-one	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelas cervicornis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes2

BINs2

Most divergent pair2.5%

Where individuals differ — all 16 variable positions, in barcode order

90Cmostly conserved

99Amostly conserved

105Tmostly conserved

174Gmostly conserved

225Cmostly conserved

261Gmostly conserved

309Tmostly conserved

315Cmostly conserved

324Gmostly conserved

381Amostly conserved

411Tmostly conserved

540Amostly conserved

543Tmostly conserved

547Cmostly conserved

618Amostly conserved

627Gmostly conserved

TTATTATTAGGAGCCTTTAGCGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGGTTAGAATTATCGGCTCCGGGCTCAATGCTAGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelas sceptrumsame genus2.0%Agelas coniferasame genus2.3%Agelas cerebrumsame genus2.3%Agelas sventressame genus7.4%Agelas clathrodessame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type75 records

Wild obs. + sensor63

Museum / vouchered12

Range

Area of Occupancy AOO92 km²

Depth

0–200 m sunlit31

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 69 m · max 78 m · 31 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 61≤1 km 2

63 georeferenced

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
WoRMS Editorial Boardlocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

2 institutions · 6 of 12 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)