Agelas dispar

Duchassaing & Michelotti, 1864 · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Agelasida/Agelasidae/Agelas

At a glance

Occurrence records418

Data sources11

Biological traits6

DNA specimens27

eDNA detections4

Sources11 archives

Databases and archives Agelas dispar's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility304 records↗

OBISOcean Biodiversity Information System114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS50 compounds

Occurrence & distributionGBIF · OBIS418 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD27 specimens

01Narrative

Agelas dispar is a species of demosponge in the family Agelasidae. It lives on shallow-water reefs in the Caribbean Sea and around the West Indies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length30 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits3

Depth max35 m

Depth min10 m

Vulnerability20

03Chemical composition50 compounds

Compounds documented for Agelas dispar across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Imidazole alkaloids9

Flavonols6

Pyrrole alkaloids5

Dipeptides4

Pyridine alkaloids3

Documented compounds50 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Dibromophakellin	present	LOTUS
(1R,5S)-3-amino-13,14-dibromo-5-methoxy-2,4,9,15-tetrazatetracyclo[7.6.0.01,5.011,15]pentadeca-2,11,13-trien-10-one	present	LOTUS
(1S,5S)-3-amino-8-bromo-2,4,6,12-tetrazatetracyclo[10.3.0.01,5.06,10]pentadeca-3,7,9-trien-11-one	present	LOTUS
(2R)-2-[(4-bromo-1H-pyrrole-2-carbonyl)amino]-3-[(4S)-3,4-dimethyl-1,5-dihydroimidazol-3-ium-4-yl]propanoate	present	NPASS
(2S)-2-[(4-bromo-1H-pyrrole-2-carbonyl)amino]-3-[(4S)-3,4-dimethyl-1,5-dihydroimidazol-3-ium-4-yl]propanoate	present	NPASS
(2S)-2-[3-[[(2R)-3,3-dimethyloxiran-2-yl]methyl]-4-hydroxyphenyl]-5,7-dihydroxy-6-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	NPASS
(3S,8R,9S,10R,13R,14R,17S)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
1-(2-hydroxyethyl)-2H-pyridine-5-carboxylic acid	present	LOTUS
2-(2-Imino-1,3-dimethylimidazol-4-yl)acetic acid	present	LOTUS
2-(2H-pyridin-1-yl)ethanesulfonic acid	present	LOTUS

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelas dispar has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes3

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

70Cmostly conserved

79Amostly conserved

85Tmostly conserved

103Tvariable

205Cmostly conserved

223Cmostly conserved

295Cmostly conserved

313Amostly conserved

361Amostly conserved

391Tmostly conserved

470Cmostly conserved

520Amostly conserved

523Tmostly conserved

527Cmostly conserved

607Gmostly conserved

CGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGGTTAGAATTATCGGCTCCGGGCTCAATGCTAGGCGATGATCAACTTTATAATGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes5

BINs2

Most divergent pair0.65%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelas sceptrumsame genus1.9%Agelas coniferasame genus2.1%Agelas cerebrumsame genus2.3%Agelas sventressame genus7.3%Agelas clathrodessame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type418 records

Wild obs. + sensor290

Museum / vouchered116

Other12

Origin

Native16

Range

Area of Occupancy AOO612 km²

Depth

0–200 m sunlit97

200–1000 m twilight2

1–4 km midnight1

>4 km abyssal0

median 18 m · max 1 422 m · 100 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 62≤1 km 31≤10 km 9>10 km 10

112 georeferenced · 178 without coordinates

Open the mapobservation + sensor290

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 4≤1 km 1≤10 km 10

15 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Masindi, UG	22
Texas Cooperative Wildlife Collectionlocation not on record	16
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	11
New Haven, US	10
Washington, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
WoRMS Editorial Boardlocation not on record	3
UM-RSMASlocation not on record	1

8 institutions · 73 of 116 vouchered records shown · 21 without an institution code

09Environmental DNA4 detections

Where the DNA of Agelas dispar was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)