Aethes tesserana

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records1 930

Data sources9

Biological traits2

DNA specimens39

eDNA detections38

Sources9 archives

Databases and archives Aethes tesserana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 930 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 930 records

Environmental DNA1 datasets · 8 countries38 detections

DNA & barcodingBOLD39 specimens

Genome at a glanceGoaT · NCBI≈486 Mbp

01Narrative

Aethes tesserana is a moth of the family Tortricidae. It is found in most of Europe, the Near East and northern Iran., 2009: Synopsis of the Cochylini (Tortricidae: Tortricinae: Cochylini) of Iran, with the description of a new species. Zootaxa 2245: 1-31. The wingspan is 12 –. Adults are on wing from May to August.UKmoths The larvae feed on the roots of Picris and Hieracium species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes tesserana has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes1

eDNA detections38

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

271Tvariable

289Amostly conserved

394Cvariable

415Avariable

427Tvariable

539Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAACCCAGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes6

BIN1

Most divergent pair2.3%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes margaritanasame genus6.2%Aethes beatricellasame genus6.5%Aethes bilbaensissame genus6.5%Aethes deutschianasame genus6.5%Aethes pierceisame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aethes tesserana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈486 122 479 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aethes tesserana0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type1 930 records

Wild obs. + sensor1 416

Museum / vouchered365

Other149

Range

Area of Occupancy AOO4 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 472≤1 km 159≤10 km 405>10 km 15

1 051 georeferenced · 365 without coordinates

Open the mapobservation + sensor1 416

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 22≤1 km 177≤10 km 43

242 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence365

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	101
DanishLepidopterologicalSocietylocation not on record	61
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	42
Tartu, EE	36
Salzburg, AT	30
Nijmegen, NL	21
Uniwersytet Łódzkilocation not on record	7
Natural History Museum Rotterdamlocation not on record	5
ZSMlocation not on record	4
Zürich, CH	4
South Kensington, GB	4
Philadelphia, US	3
Kuopio, FI	3
University of Kaiserslauternlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Colorado State Universitylocation not on record	1
Natural History Museum, Londonlocation not on record	1

20 institutions · 331 of 365 vouchered records shown · 34 without an institution code

09Environmental DNA38 detections

Where the DNA of Aethes tesserana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map8 countries0

edge forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 7.40–18.6

Seasonal swing summer↔winter19.2 °C

Max temp (day)19.6 °C 11.5–23.0

Min temp (night)9.10 °C 1.10–13.8

Precipitation86.1 mm/mo 53.2–172

Air humidity59.9 % 55.4–63.2

Moisture balance-20.2 mm/mo -85.6–67.8

Vapour deficit709 Pa 384–914

Wind speed3.00 m/s 1.60–4.10

Cloud cover37.6 % 31.8–41.4

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aethes tesserana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 930 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 930 records