Aethes margaritana

(Haworth, 1811) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records3 139

Data sources8

Biological traits2

DNA specimens15

eDNA detections17

Sources8 archives

Databases and archives Aethes margaritana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 139 records

Environmental DNA2 datasets · 5 countries17 detections

DNA & barcodingBOLD15 specimens

01Narrative

Aethes margaritana, the silver coast conch, is a moth of the family Tortricidae. It was described by Adrian Hardy Haworth in 1811. It is found in most of Europe. The habitat consists of downland, waste ground and shingle beaches.Hantsmoths The wingspan is 12 –.Microlepidoptera.nl Adults have a silky-white ground colour with yellow-ochreous transverse markings. They are on wing from May to June and again from July to August in two generations per year.Lepidoptera of Belgium The larvae feed on Chrysanthemum, Tanacetum, Achillea, Matricaria and Chamomilla species. They live in the flowers and seeds of their host plant. The species overwinters and pupates in the larval habitation during spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes margaritana has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections17

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

85Tmostly conserved

118Tmostly conserved

205Amostly conserved

316Amostly conserved

364Cmostly conserved

385Tmostly conserved

628Amostly conserved

652Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTCTTAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes6

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes scalanasame genus5.3%Aethes kindermannianasame genus6.1%Aethes smeathmannianasame genus6.2%Aethes tesseranasame genus6.2%Aethes fennicanasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 139 records

Wild obs. + sensor2 617

Museum / vouchered510

Other12

Origin

Native3

Range

Area of Occupancy AOO5 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 1 313≤1 km 817≤10 km 362>10 km 2

2 494 georeferenced · 123 without coordinates

Open the mapobservation + sensor2 617

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 165≤1 km 98≤10 km 136

399 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence510

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	209
NHMOlocation not on record	51
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	42
SLU Artdatabankenlocation not on record	32
Tartu, EE	24
Philadelphia, US	22
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	17
Kuopio, FI	16
ZMAAlocation not on record	12
Stockholm, SE	11
Nijmegen, NL	8
Rovaniemi, FI	6
Provincia di Livornolocation not on record	5
Tallinn, EE	4
ZSMlocation not on record	4
DABUHlocation not on record	4
University of Kaiserslauternlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
BioFokuslocation not on record	1
Metsähallituslocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

22 institutions · 475 of 510 vouchered records shown · 35 without an institution code

09Environmental DNA17 detections

Where the DNA of Aethes margaritana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys2

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 10.7–19.0

Seasonal swing summer↔winter19.8 °C

Max temp (day)21.2 °C 14.2–23.5

Min temp (night)12.9 °C 4.20–14.1

Precipitation73.9 mm/mo 59.2–92.6

Air humidity58.1 % 57.4–59.7

Moisture balance-39.4 mm/mo -60.8–-31.1

Vapour deficit792 Pa 542–926

Wind speed2.80 m/s 2.40–4.00

Cloud cover35.7 % 31.7–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aethes margaritana

At a glance

Sources8 archives

Diet & foraging2

At a glance

Record type3 139 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 139 records