Aethes kindermanniana

(Treitschke, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records530

Data sources8

Biological traits0

DNA specimens15

eDNA detections14

Sources8 archives

Databases and archives Aethes kindermanniana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility530 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF530 records

Environmental DNA1 datasets · 7 countries14 detections

DNA & barcodingBOLD15 specimens

01Narrative

Aethes kindermanniana is a species of moth of the family Tortricidae. It was described by Treitschke in 1830. It is found on Sardinia and in Denmark, Germany, France, Spain, Italy, Switzerland, Austria, the Czech Republic, Slovakia, Poland, Hungary, Romania, Norway, Sweden, Finland, the Baltic region, Ukraine, Russia. and Asia Minor.Aethes at funet It has also been recorded from North America.Moth Photographers Group The wingspan is 13 –. Adults are on wing in March and from May to August. The larvae feed on Artemisia campestris, Chrysanthemum species and Tanacetum corymbosum. Larvae can be found nearly year round.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes kindermanniana has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections14

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

40Amostly conserved

82Tmostly conserved

85Cvariable

99Gmostly conserved

100Tmostly conserved

103Cmostly conserved

111Tmostly conserved

127Tmostly conserved

205Amostly conserved

208Amostly conserved

212Cvariable

220Cvariable

229Amostly conserved

232Tvariable

238Avariable

287Tmostly conserved

304Tvariable

313Tmostly conserved

370Tmostly conserved

397Tmostly conserved

477Amostly conserved

508Amostly conserved

511Avariable

520Amostly conserved

539Cvariable

541Amostly conserved

565Amostly conserved

616Tvariable

641Tmostly conserved

AACCTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes9

BIN1

Most divergent pair2.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes smeathmannianasame genus3.3%Aethes margaritanasame genus6.1%Aethes kyrkiisame genus6.2%Aethes bilbaensissame genus6.7%Aethes francillanasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type530 records

Wild obs. + sensor255

Museum / vouchered275

Range

Area of Occupancy AOO908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 97≤1 km 120≤10 km 26>10 km 4

247 georeferenced · 8 without coordinates

Open the mapobservation + sensor255

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 47≤1 km 56≤10 km 50

153 georeferenced · 122 without coordinates

Open the institutions mapphysical evidence275

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	60
DanishLepidopterologicalSocietylocation not on record	54
Tartu, EE	44
NHMOlocation not on record	26
SLU Artdatabankenlocation not on record	21
Provincia di Livornolocation not on record	11
Philadelphia, US	9
ZMAAlocation not on record	8
Kuopio, FI	4
Rovaniemi, FI	3
Vernal, US	2
Stockholm, SE	2
NMBU:MINAlocation not on record	1
ZAF-UMUlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Uniwersytet Łódzkilocation not on record	1

16 institutions · 248 of 275 vouchered records shown · 27 without an institution code

09Environmental DNA14 detections

Where the DNA of Aethes kindermanniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 6.10–21.2

Seasonal swing summer↔winter21.4 °C

Max temp (day)18.5 °C 10.0–25.5

Min temp (night)14.5 °C 0.6–15.1

Precipitation63.9 mm/mo 53.4–87.5

Air humidity57.4 % 53.8–62.6

Moisture balance-47.4 mm/mo -83.1–-17.4

Vapour deficit736 Pa 392–1,167

Wind speed3.00 m/s 2.10–4.70

Cloud cover38.2 % 25.1–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)