Aethes bilbaensis

(Rössler, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records239

Data sources8

Biological traits2

DNA specimens25

eDNA detections22

Sources8 archives

Databases and archives Aethes bilbaensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 9 countries22 detections

DNA & barcodingBOLD25 specimens

01Narrative

Aethes bilbaensis is a species of moth of the family Tortricidae. It is found in Morocco, Algeria, the Iberian Peninsula, southern France, Italy, Croatia, Albania, Greece, Austria, the Czech Republic, Slovakia, Hungary, Romania, Bulgaria, Russia, Asia Minor, the Palestinian territories, Lebanon, Iran, Afghanistan, Pakistan, Kazakhstan,, 2010: Clepsis trifasciata sp. n. with notes on some Lepidoptera Tortricidae from Kirgizstan. Journal of Entomological and Acarological Research Serie II 42 (1): 1-10. Kyrgyzstan and Turkmenistan.Aethes at funet It is found in xerothermic (hot and dry) habitats. The wingspan is 10 –. Adults are on wing from May to June and again from July to September in two generations per year. The larvae feed on Crithmum maritimum and Carum verticillatum. The species overwinters in the larval stage.Bugwood Wiki

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes bilbaensis has left across the world's sequence archives.

At a glance

DNA specimens25

BINs7

Marker genes1

eDNA detections22

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

10Cvariable

34Amostly conserved

40Amostly conserved

43Amostly conserved

64Tmostly conserved

82Tvariable

85Cvariable

106Tvariable

133Tmostly conserved

142Tmostly conserved

157Tvariable

166Amostly conserved

169Tmostly conserved

206Tmostly conserved

211Amostly conserved

217Avariable

220Tmostly conserved

223Avariable

229Amostly conserved

235Tmostly conserved

238Amostly conserved

244Avariable

253Amostly conserved

274Avariable

284Tvariable

286Amostly conserved

287Tvariable

316Amostly conserved

337Gvariable

358Tmostly conserved

364Cmostly conserved

373Amostly conserved

382Tmostly conserved

397Cvariable

400Cvariable

409Amostly conserved

454Avariable

469Amostly conserved

500Cvariable

514Tmostly conserved

536Tmostly conserved

538Amostly conserved

550Tvariable

553Tmostly conserved

562Tmostly conserved

574Tmostly conserved

586Tmostly conserved

596Tvariable

625Tvariable

628Amostly conserved

634Cvariable

646Tmostly conserved

AACATTATACTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGTAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes16

BINs7

Most divergent pair5.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes beatricellasame genus3.6%Aethes fennicanasame genus4.0%Aethes confinissame genus4.1%Aethes dilucidanasame genus4.1%Aethes rubiginanasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type239 records

Wild obs. + sensor217

Museum / vouchered22

Origin

Native1

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 31≤1 km 51≤10 km 64>10 km 2

148 georeferenced · 69 without coordinates

Open the mapobservation + sensor217

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 4≤1 km 1≤10 km 6

11 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	5
ZAF-UMUlocation not on record	5
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	3

3 institutions · 13 of 22 vouchered records shown · 9 without an institution code

09Environmental DNA22 detections

Where the DNA of Aethes bilbaensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map9 countries0

olive plantation/meadow32

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 19.1–24.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)25.1 °C 22.7–28.8

Min temp (night)16.8 °C 14.4–21.1

Precipitation46.5 mm/mo 18.3–91.8

Air humidity57.9 % 55.3–62.3

Moisture balance-95.1 mm/mo -131–-39.5

Vapour deficit1,073 Pa 929–1,314

Wind speed3.10 m/s 2.70–3.90

Cloud cover34.5 % 25.5–38.5

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)