Aethes dilucidana

(Stephens, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records200

Data sources8

Biological traits2

DNA specimens16

eDNA detections15

Sources8 archives

Databases and archives Aethes dilucidana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF200 records

Environmental DNA1 datasets · 5 countries15 detections

DNA & barcodingBOLD16 specimens

01Narrative

Aethes dilucidana, the short-barred yellow conch, is a species of moth of the family Tortricidae. It was described by Stephens in 1852. It is found in most of Europe, Algeria,Aethes at funet southern Siberia, Kazakhstan, Turkmenistan, Kyrgyzstan and Iran., 2010: Clepsis trifasciata sp. n. with notes on some Lepidoptera Tortricidae from Kirgizstan. Journal of Entomological and Acarological Research Serie II 42 (1): 1-10. The wingspan is 14 –. Adults are on wing from June to July. The larvae feed on Peucedanum sativum, Pastinaca sativa and Heracleum sphondylium. Larvae can be found from August to April.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes dilucidana has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections15

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

16Cmostly conserved

40Amostly conserved

100Amostly conserved

145Tmostly conserved

184Amostly conserved

190Amostly conserved

226Tmostly conserved

271Cmostly conserved

328Gvariable

477Amostly conserved

610Tmostly conserved

613Cvariable

646Tmostly conserved

AACATTATATTTTATCTTTGGTATTTGAGCAGGTATAGTAGGAACCTCTTTAAGACTTTTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes6

BIN1

Most divergent pair1.2%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes beatricellasame genus4.0%Aethes bilbaensissame genus4.1%Aethes francillanasame genus5.2%Aethes kasyisame genus5.2%Aethes fennicanasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type200 records

Wild obs. + sensor142

Museum / vouchered58

Range

Area of Occupancy AOO376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 36≤1 km 13≤10 km 79

128 georeferenced · 14 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 17≤1 km 13≤10 km 7

37 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	20
SLU Artdatabankenlocation not on record	16
DanishLepidopterologicalSocietylocation not on record	10
ZSMlocation not on record	3
Research Collection of Kai Berggrenlocation not on record	3
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
South Kensington, GB	1

7 institutions · 54 of 58 vouchered records shown · 4 without an institution code

09Environmental DNA15 detections

Where the DNA of Aethes dilucidana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 14.4–19.0

Seasonal swing summer↔winter18.5 °C

Max temp (day)21.8 °C 16.3–23.5

Min temp (night)13.7 °C 11.7–14.1

Precipitation73.1 mm/mo 45.1–99.5

Air humidity58.6 % 57.9–60.3

Moisture balance-50.5 mm/mo -91.9–-32.3

Vapour deficit829 Pa 657–928

Wind speed3.00 m/s 2.10–4.20

Cloud cover31.8 % 24.4–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)