Aethes beatricella

(Walsingham, 1898) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records486

Data sources8

Biological traits2

DNA specimens7

eDNA detections5

Sources8 archives

Databases and archives Aethes beatricella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility486 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF486 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Aethes beatricella, the hemlock yellow conch, is a species of moth of the family Tortricidae. It was described by Walsingham in 1898. It is found in Great Britain, Sweden, Denmark, the Netherlands, France, Spain, Italy, Austria, the Czech Republic, Slovakia, Hungary, Bosnia and Herzegovina, Romania, Ukraine, Russia and Algeria. The habitat consists of waste grounds, woodland fringes and hedgerows. The wingspan is 14 –. Adults are on wing from June to July.UKmoths The larvae feed on Pastinaca sativaAethes at funet and Conium species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes beatricella has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections5

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

19Tmostly conserved

88Amostly conserved

139Tvariable

202Amostly conserved

232Cmostly conserved

337Gvariable

400Cvariable

428Tvariable

518Gmostly conserved

547Avariable

556Tmostly conserved

571Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.72%

Haplotypes3

BINs2

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes bilbaensissame genus3.6%Aethes dilucidanasame genus4.0%Aethes kasyisame genus4.1%Aethes fennicanasame genus4.1%Aethes francillanasame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type486 records

Wild obs. + sensor419

Museum / vouchered67

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 110≤1 km 29≤10 km 271

410 georeferenced · 9 without coordinates

Open the mapobservation + sensor419

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 17≤1 km 12≤10 km 18

47 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	39
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	7
Nijmegen, NL	4
SLU Artdatabankenlocation not on record	4
South Kensington, GB	3

5 institutions · 57 of 67 vouchered records shown · 10 without an institution code

09Environmental DNA5 detections

Where the DNA of Aethes beatricella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 14.8–17.5

Seasonal swing summer↔winter15.4 °C

Max temp (day)17.7 °C 17.4–20.5

Min temp (night)11.5 °C 11.4–14.3

Precipitation56.4 mm/mo 54.2–100

Air humidity62.4 % 59.7–62.7

Moisture balance-69.0 mm/mo -72.4–-38.0

Vapour deficit666 Pa 632–810

Wind speed4.60 m/s 2.90–4.80

Cloud cover42.2 % 36.7–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)