Aethes piercei

Obraztsov, 1952 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records150

Data sources7

Biological traits2

DNA specimens5

eDNA detections0

Sources7 archives

Databases and archives Aethes piercei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility150 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF150 records

DNA & barcodingBOLD5 specimens

01Narrative

Aethes piercei, the devil's-bit conch, is a species of moth of the family Tortricidae. It is found in central, southern and western Europe.Aethes at funet The habitat consists of damp areas, including marshes and fens. The wingspan is 14 –. Adults are on wing from June to July. The larvae feed on Succisa pratensis. They feed in the roots of their host plant.UKmoths

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes piercei has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

19Cvariable

59Cmostly conserved

68Gmostly conserved

73Amostly conserved

106Cmostly conserved

115Tmostly conserved

124Cmostly conserved

214Amostly conserved

271Amostly conserved

280Tmostly conserved

281Amostly conserved

287Cmostly conserved

364Tmostly conserved

367Cmostly conserved

451Cmostly conserved

466Avariable

483Gmostly conserved

490Cmostly conserved

514Cvariable

517Amostly conserved

529Cmostly conserved

562Amostly conserved

616Tmostly conserved

628Amostly conserved

AACATTATATTTTATTTTCGGTATTTGAGCAGGTATAATTGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes4

BINs2

Most divergent pair3.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes caucasicasame genus5.5%Aethes nefandanasame genus5.9%Aethes tesseranasame genus6.5%Aethes kyrkiisame genus7.1%Aethes kasyisame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type150 records

Wild obs. + sensor147

Museum / vouchered3

Range

Area of Occupancy AOO348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 36≤1 km 29≤10 km 45

110 georeferenced · 37 without coordinates

Open the mapobservation + sensor147

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	2
Bavarian State Collection of Zoologylocation not on record	1

2 institutions · 3 of 3 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)