Aedes multiplex

(Theobald, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records137

Data sources4

Biological traits0

DNA specimens7

eDNA detections7

Sources4 archives

Databases and archives Aedes multiplex's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Ochlerotatus multiplex is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1903 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes multiplex has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P676 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes2

BINs3

Most divergent pair2.1%

Where individuals differ — all 28 variable positions, in barcode order

10Gvariable

52Gvariable

97Avariable

109Gvariable

172Gvariable

181Tvariable

277Tvariable

328Cvariable

352Cvariable

388Tvariable

391Tvariable

424Avariable

439Avariable

442Avariable

463Tmostly conserved

470Amostly conserved

472Cvariable

475Avariable

503Tvariable

505Avariable

508Cvariable

571Cvariable

574Gvariable

637Amostly conserved

640Avariable

643Cvariable

661Cvariable

676Gmostly conserved

AGATATTGGGACATTATACTTTATTTTTGGAGTTTGATCTGGAATAATTGGGACATCTTTAAGTGTATTAGTTCGTGCTGAATTAAGTCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes melanimonsame genus9.1%Aedes dorsalissame genus9.3%Aedes cantatorsame genus9.9%Aedes bancroftianussame genus10.0%Aedes caspiussame genus10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type137 records

Wild obs. + sensor103

Museum / vouchered34

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 101≤10 km 1

102 georeferenced · 1 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	27
University of Queensland Insect Collectionlocation not on record	5
Australian National Fish Collectionlocation not on record	2

3 institutions · 34 of 34 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Aedes multiplex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 19.9–24.5

Seasonal swing summer↔winter9.80 °C

Max temp (day)25.5 °C 23.4–27.7

Min temp (night)19.0 °C 16.6–21.4

Precipitation152 mm/mo 137–168

Air humidity59.7 % 58.7–60.6

Moisture balance-3.30 mm/mo -16.3–9.80

Vapour deficit1,087 Pa 968–1,206

Wind speed3.10 m/s 3.00–3.10

Cloud cover27.0 % 24.6–29.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)