Aedes detritus

(Haliday, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records4 084

Data sources6

Biological traits2

DNA specimens136

eDNA detections159

Sources6 archives

Databases and archives Aedes detritus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 084 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI159 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics136 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 084 records

Environmental DNA3 datasets · 10 countries159 detections

DNA & barcodingBOLD136 specimens

01Narrative

Ochlerotatus detritus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1833 door Haliday.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)omnivore

05DNA & barcoding136 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes detritus has left across the world's sequence archives.

At a glance

DNA specimens136

BINs1

Marker genes4

eDNA detections159

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus123 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

172Cmostly conserved

229Amostly conserved

328Gmostly conserved

421Tmostly conserved

445Cmostly conserved

553Gmostly conserved

568Cmostly conserved

578Cmostly conserved

589Cmostly conserved

616Tmostly conserved

634Cmostly conserved

AACTTTATATTTTATTTTTGGGGTTTGATCAGGAATAGTTGGTACATCTTTAAGTATTTTAATTCGAGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes35

BIN1

Most divergent pair3.0%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes cantatorsame genus6.8%Aedes intrudenssame genus7.4%Aedes camptorhynchussame genus7.6%Aedes dorsalissame genus7.8%Aedes aurifersame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type4 084 records

Wild obs. + sensor3 952

Museum / vouchered130

Other2

Origin

Native63

Range

Area of Occupancy AOO1 240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 71≤1 km 20≤10 km 3 477>10 km 1

3 569 georeferenced · 383 without coordinates

Open the mapobservation + sensor3 952

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 34≤1 km 5≤10 km 8

47 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence130

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	48
Washington, US	41
RBINS-Scientific Heritagelocation not on record	9
Animal and Plant Health Agency, UKlocation not on record	4
BMNHlocation not on record	4
DFlocation not on record	2
NPlocation not on record	1
DFFW2016location not on record	1
University of Queensland Insect Collectionlocation not on record	1
Tartu, EE	1
SLU Artdatabankenlocation not on record	1

11 institutions · 113 of 130 vouchered records shown · 17 without an institution code

09Environmental DNA159 detections

Where the DNA of Aedes detritus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found159

Studies independent surveys3

Countries10

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 159 detections have coordinates

Open the map10 countries0

Family-run diary and arable farmGrazing areas on fenlandSalt MarshLagunaGrazing marshUrban city farm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 6.50–16.9

Seasonal swing summer↔winter11.7 °C

Max temp (day)16.2 °C 8.00–19.8

Min temp (night)10.0 °C 3.00–13.6

Precipitation70.1 mm/mo 53.7–166

Air humidity63.2 % 59.3–64.1

Moisture balance-12.6 mm/mo -72.9–104

Vapour deficit566 Pa 352–725

Wind speed4.50 m/s 3.10–6.50

Cloud cover45.0 % 39.0–52.5

CHELSA 1981–2010, ~9 km grid, at location & month of 109 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes detritus

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type4 084 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 084 records