Aculepeira carbonarioides

(Keyserling, 1892) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Aculepeira

At a glance

Occurrence records169

Data sources7

Biological traits0

DNA specimens6

eDNA detections0

Sources7 archives

Databases and archives Aculepeira carbonarioides's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility169 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF169 records

DNA & barcodingBOLD6 specimens

01Narrative

Aculepeira carbonarioides is a spider in the orb-weaver family (Araneidae). It is commonly found in the rocky crevices of boulder-strewn slopes, at or close by the tree line; reported from Canada (Alberta, British Columbia, Northwest Territory, Quebec and Yukon Territory) and the United States (Alaska, Colorado, New Hampshire, Utah and Wyoming). A. carbonarioides reportedly stays in the center of its web during daylight hours.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aculepeira carbonarioides has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BINs2

Most divergent pair4.6%

Where individuals differ — all 30 variable positions, in barcode order

19Tmostly conserved

56Amostly conserved

94Gmostly conserved

97Gmostly conserved

163Gmostly conserved

217Cmostly conserved

220Amostly conserved

226Gmostly conserved

235Amostly conserved

253Gmostly conserved

268Cvariable

325Gmostly conserved

347Gmostly conserved

358Gmostly conserved

409Cmostly conserved

424Tmostly conserved

484Gmostly conserved

493Gmostly conserved

505Gmostly conserved

550Cmostly conserved

553Tmostly conserved

565Tmostly conserved

577Gmostly conserved

583Gmostly conserved

601Cmostly conserved

613Tmostly conserved

619Amostly conserved

622Gmostly conserved

628Gmostly conserved

631Tmostly conserved

TTTATATTTAATTTTTGGTGCTTGAGCTGCTATAGTTGGTACTGCAATAAGAGTAATAATTCGAATTGAATTAGGTCAACCTGGAAGATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aculepeira packardisame genus8.3%Aculepeira ceropegiasame genus8.6%Aculepeira armidasame genus8.7%Argiope pulchellasame family9.8%Nuctenea silvicultrixsame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type169 records

Wild obs. + sensor115

Museum / vouchered54

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 58≤1 km 20≤10 km 8>10 km 7

93 georeferenced · 22 without coordinates

Open the mapobservation + sensor115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 5≤1 km 2≤10 km 3>10 km 6

16 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ekaterinburg, RU	14
Denver, US	6
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	4
Edmonton, CA	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 27 of 54 vouchered records shown · 27 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)