Aculepeira ceropegia

(Walckenaer, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Aculepeira

At a glance

Occurrence records13 453

Data sources9

Biological traits9

DNA specimens52

eDNA detections1

Sources9 archives

Databases and archives Aculepeira ceropegia's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 453 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

World Spider Trait DBMasaryk University9 traits · 22 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements22 literature sources9 traits

Occurrence & distributionGBIF13 453 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD52 specimens

01Narrative

Aculepeira ceropegia, the oak spider, is an orb-weaving spider species belonging to the family Araneidae.Norman I. Platnick, 2006. The World Spider Catalog, Version 7.0. American Museum of Natural HistoryAnimal Diversity Web

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 22 sources

Entling et al. 2007Buchar & Růžička 2002Hyvärinen et al. 2019Staręga et al. 2001Henriksen & Hilmo 2015Gajdoš et al. 2014Liste France 2018SLU 2020Bruun & Lissner 2019Blick et al. 2016Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Řezáč et al. 2015Nentwig et al. 2018Cardoso et al. 2011Pekár et al. 2012a

Morphometry1

Body length♀14·♂8 mm

Predation2

Hunting guildorb web weavers

Prey diversity1.43 mm

Ecology6

Light0.625 mm

Light 2partly shaded

Moisture 10.375 mm

Moisture 2dry

Regional IUCN Red List categoryVulnerable (VU)

Regional non-IUCN Red List categoryLeast Concern (*)

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aculepeira ceropegia has left across the world's sequence archives.

At a glance

DNA specimens52

BINs1

Marker genes1

eDNA detections1

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

31Gmostly conserved

40Amostly conserved

46Amostly conserved

160Amostly conserved

181Gmostly conserved

343Amostly conserved

355Gmostly conserved

379Tmostly conserved

466Gmostly conserved

478Amostly conserved

494Gmostly conserved

499Cmostly conserved

502Amostly conserved

562Tmostly conserved

568Tmostly conserved

625Amostly conserved

637Tmostly conserved

AACTTTATATTTAATTTTTGGGGCTTGGGCGGCTATAGTAGGTACAGCTATAAGAGTATTAATTCGAATTGAATTAGGTCAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes13

BIN1

Most divergent pair2.3%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aculepeira armidasame genus4.3%Aculepeira packardisame genus6.5%Aculepeira carbonarioidessame genus8.6%Neoscona subfuscasame family9.5%Larinioides patagiatussame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type13 453 records

Wild obs. + sensor12 556

Museum / vouchered880

Cultivated / captive4

Other13

Origin

Native635

Range

Area of Occupancy AOO30 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 4 755≤1 km 2 152≤10 km 2 487>10 km 253

9 647 georeferenced · 2 909 without coordinates

Open the mapobservation + sensor12 556

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 117≤1 km 30≤10 km 491>10 km 18

656 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence880

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Akademia Pomorska w Słupskulocation not on record	109
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	53
Brussels, BE	31
Bonn, DE	25
Helsinki, FI	24
Adam Mickiewicz University in Poznańlocation not on record	23
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	21
Frankfurt am Main	20
	15
Bern, CH	12
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	10
Paro, BT	8
European Distributed Institute of Taxonomy (EDIT)location not on record	7
Prioksko-Terrasnyi Biosphere Reservelocation not on record	6
Tartu, EE	6
SLU Artdatabankenlocation not on record	6
Geneva, CH	4
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
Uniwersytet w Białymstokulocation not on record	3
Rovaniemi, FI	3
Washington, US	3
ZSMlocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Philadelphia, US	1
University of Tokyo, Department of Zoologylocation not on record	1
Research Collection of E. Kuzminlocation not on record	1
Copenhagen, DK	1
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	1
Ekaterinburg, RU	1

29 institutions · 403 of 880 vouchered records shown · 477 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Aculepeira ceropegia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 19.1–19.1

Seasonal swing summer↔winter31.1 °C

Max temp (day)23.2 °C

Min temp (night)14.2 °C

Precipitation69.1 mm/mo

Air humidity55.7 %

Moisture balance-57.1 mm/mo

Vapour deficit987 Pa

Wind speed2.40 m/s

Cloud cover40.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aculepeira ceropegia

At a glance

Sources9 archives

Morphometry1

Predation2

Ecology6

At a glance

Record type13 453 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type13 453 records