Aculepeira armida

(Audouin, 1826) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Aculepeira

At a glance

Occurrence records1 569

Data sources8

Biological traits2

DNA specimens21

eDNA detections0

Sources8 archives

Databases and archives Aculepeira armida's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 569 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

World Spider Trait DBMasaryk University2 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources2 traits

Occurrence & distributionGBIF1 569 records

DNA & barcodingBOLD21 specimens

01Narrative

Aculepeira armida is an orb-weaver spider species (family Araneidae) with a wide distribution in North Africa, Southern Europe, Westren Asia, Russia (from Europe to the Far East), and Central Asia to China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGajdoš & Svatoň 2001Groppali & Priano 1992

Ecology2

Regional IUCN Red List categoryExtinct (EX)

Regional non-IUCN Red List categoryRare (R)

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aculepeira armida has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

1Amostly conserved

22Gmostly conserved

205Tmostly conserved

217Gmostly conserved

274Cmostly conserved

319Amostly conserved

421Tmostly conserved

475Tmostly conserved

580Amostly conserved

649Gmostly conserved

AACTTTATATTTAATTTTTGGGGCTTGGGCCGCTATAGTAGGTACGGCTATAAGAGTATTAATTCGAGTTGAATTAGGTCAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes7

BIN1

Most divergent pair1.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aculepeira ceropegiasame genus4.3%Aculepeira packardisame genus6.1%Aculepeira carbonarioidessame genus8.7%Larinioides cornutussame family10.0%Neoscona pratensissame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 569 records

Wild obs. + sensor1 465

Museum / vouchered103

Other1

Range

Area of Occupancy AOO4 416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 365≤1 km 176≤10 km 308>10 km 48

897 georeferenced · 568 without coordinates

Open the mapobservation + sensor1 465

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 1≤10 km 57>10 km 7

65 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	8
	6
Ekaterinburg, RU	5
ULLlocation not on record	4

4 institutions · 23 of 103 vouchered records shown · 79 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aculepeira armida

At a glance

Sources8 archives

Ecology2

At a glance

Record type1 569 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 4 geolocated

Record type1 569 records