Aculepeira packardi

(Thorell, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Aculepeira

At a glance

Occurrence records415

Data sources9

Biological traits4

DNA specimens17

eDNA detections58

Sources9 archives

Databases and archives Aculepeira packardi's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility415 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

World Spider Trait DBMasaryk University4 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF415 records

Environmental DNA1 datasets · 3 countries58 detections

DNA & barcodingBOLD17 specimens

01Narrative

Aculepeira packardi is a species of orb weaver in the spider family Araneidae. It is found in North America, Russia, China, and Kazakhstan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSmith et al. 2016

Predation3

Prey size3.1 mm

Web area491 mm

Web diameter12.5 mm

Reproduction1

Number of eggsacs1 mm

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aculepeira packardi has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections58

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

5Tmostly conserved

7Amostly conserved

16Cmostly conserved

31Tmostly conserved

43Avariable

45Cmostly conserved

109Amostly conserved

145Gvariable

217Gmostly conserved

271Cvariable

280Gmostly conserved

322Amostly conserved

325Cmostly conserved

343Cmostly conserved

352Tmostly conserved

361Amostly conserved

379Tmostly conserved

415Gmostly conserved

436Cmostly conserved

469Amostly conserved

478Avariable

508Amostly conserved

538Gvariable

604Gmostly conserved

622Amostly conserved

631Gvariable

TACTTTATATTTAATCTTTGGTGCATGGGCTGCTATAGTAGGAACGGCTATAAGAGTATTAATTCGAGTTGAATTAGGTCAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes5

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aculepeira armidasame genus6.1%Aculepeira ceropegiasame genus6.5%Aculepeira carbonarioidessame genus8.3%Neoscona subfuscasame family10.4%Eriophora fuligineasame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type415 records

Wild obs. + sensor254

Museum / vouchered161

Range

Area of Occupancy AOO1 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 133≤1 km 28≤10 km 11>10 km 12

184 georeferenced · 70 without coordinates

Open the mapobservation + sensor254

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 6≤10 km 4>10 km 9

19 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	57
University of Guelph, Centre for Biodiversity Genomicslocation not on record	31
Albuquerque, US	21
San Francisco, US	9
München, DE	6
Edmonton, CA	4
Cambridge, US	3
Ekaterinburg, RU	2
Helsinki, FI	2
San Diego, US	1
La Paz, MX	1
Natural History Museum of Utahlocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
University of Alaska Museumlocation not on record	1
Frankfurt am Main	1

15 institutions · 141 of 161 vouchered records shown · 19 without an institution code

09Environmental DNA58 detections

Where the DNA of Aculepeira packardi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map3 countries0

Forest1. Forest & Woodland | 1.1. Boreal Forest5. Wetlands (inland) | 5.4. Bogs, Marshes, S…4. Native Grassland | 4.4. Temperate GrasslandWetlandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 3.50–14.7

Seasonal swing summer↔winter35.2 °C

Max temp (day)15.1 °C 8.30–20.9

Min temp (night)8.20 °C -1.60–9.30

Precipitation88.0 mm/mo 45.4–145

Air humidity61.1 % 54.1–63.2

Moisture balance10.2 mm/mo -87.6–31.3

Vapour deficit510 Pa 298–736

Wind speed2.50 m/s 1.90–7.90

Cloud cover41.6 % 35.4–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)