Acrobasis stigmella

Dyar, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records107

Data sources7

Biological traits0

DNA specimens12

eDNA detections1

Sources7 archives

Databases and archives Acrobasis stigmella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF107 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acrobasis stigmella is a species of snout moth in the genus Acrobasis. It was described by Harrison Gray Dyar Jr. in 1908, and is known from Ontario, Canada, and the eastern United States. There is probably only one generation per year. The larvae feed on Carya species, including Carya tomentosa, Carya glabra and Carya pallida. They generally feed on the buds of their host plant, but may also feed within a shoot for a short period of time. The species overwinters in the larval stage. Pupation takes place in the soil.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis stigmella has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

206Tmostly conserved

634Tmostly conserved

AACTTTATATTTTATCTTAGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis ostryellasame genus3.3%Acrobasis normellasame genus3.3%Acrobasis demotellasame genus3.5%Acrobasis carpinivorellasame genus3.6%Acrobasis betulivorellasame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type107 records

Wild obs. + sensor31

Museum / vouchered76

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 10≤1 km 9>10 km 5

24 georeferenced · 7 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 8≤1 km 4≤10 km 7>10 km 3

22 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	35
Mississippi State, US	22
Decorah, US	5
East Lansing, US	4
New Haven, US	3
CUlocation not on record	3
Cornell University Insect Collectionlocation not on record	2
Washington, US	1
Mississippi Entomological Museumlocation not on record	1

9 institutions · 76 of 76 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Acrobasis stigmella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 26.7–26.7

Seasonal swing summer↔winter19.9 °C

Max temp (day)32.0 °C

Min temp (night)22.4 °C

Precipitation109 mm/mo

Air humidity60.9 %

Moisture balance-40.2 mm/mo

Vapour deficit1,366 Pa

Wind speed1.30 m/s

Cloud cover26.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)